Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1210
Trapped Gene
Cops2 (ENSMUSG00000027206)
Vector Insertion
Chr 2: 125670672 - 125673942
Public Clones CE0085 (sanger) AW0874 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000324763 (Chr2:125673943..125674020 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAATGGGGATTCAAAGC Chr2:125673977..125673996 60.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000324763 (Chr2:125673943..125674020 -)
Downstram Exon
ENSMUSE00000166987 (Chr2:125670546..125670671 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAATGGGGATTCAAAGC Chr2:125673977..125673996 60.78 50 TGGTGACTGCACTCCGAATA Chr2:125670583..125670602 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000166989 Chr2:125684672..125684737 GGATGATTTCATGTGCGATG Chr2:125684692..125684711 59.89 45
upstream ENSMUSE00000684023 Chr2:125684672..125684775 GGATGATTTCATGTGCGATG Chr2:125684692..125684711 59.89 45
upstream ENSMUSE00000684029 Chr2:125684672..125684875 GGATGATTTCATGTGCGATG Chr2:125684692..125684711 59.89 45
upstream ENSMUSE00000324768 Chr2:125675476..125675589 TCTGAGCCCAATGTGGATTT Chr2:125675549..125675568 60.46 45
upstream ENSMUSE00000324763 Chr2:125673943..125674020 GGAGAATGGGGATTCAAAGC Chr2:125673977..125673996 60.78 50

*** Putative Vector Insertion (Chr 2: 125670672 - 125673942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000166987 Chr2:125670546..125670671 TGGTGACTGCACTCCGAATA Chr2:125670583..125670602 60.26 50
downstream ENSMUSE00000166983 Chr2:125668358..125668447 No primer for this exon
downstream ENSMUSE00000684042 Chr2:125668358..125668468 CCTGCAGTAAATCCATCTGACA Chr2:125668410..125668431 60.13 45.46
downstream ENSMUSE00000166984 Chr2:125668169..125668246 No primer for this exon
downstream ENSMUSE00000684022 Chr2:125666204..125666234 No primer for this exon
downstream ENSMUSE00000166979 Chr2:125666060..125666234 CCCATGATTAGTGGGTGAGG Chr2:125666049..125666068 60.19 55
downstream ENSMUSE00000166980 Chr2:125665042..125665220 TCTTGGGCTTCCTGATTCAT Chr2:125665098..125665117 59.63 45
downstream ENSMUSE00000684035 Chr2:125664890..125664937 No primer for this exon
downstream ENSMUSE00000166986 Chr2:125664885..125664937 No primer for this exon
downstream ENSMUSE00000166982 Chr2:125661878..125661975 TCATCCATGATGTTGCTGTG Chr2:125661882..125661901 59.03 45
downstream ENSMUSE00000684033 Chr2:125661878..125661980 TCATCCATGATGTTGCTGTG Chr2:125661882..125661901 59.03 45
downstream ENSMUSE00000166990 Chr2:125660490..125660572 No primer for this exon
downstream ENSMUSE00000166988 Chr2:125659460..125659518 ATCCAGTATGCACTGCACCA Chr2:125659440..125659459 60.14 50
downstream ENSMUSE00000684021 Chr2:125657335..125658073 CTGCTTGAGCCCTAGGTGAC Chr2:125657343..125657362 60.01 60
downstream ENSMUSE00000410580 Chr2:125656040..125658073 CTGCTTGAGCCCTAGGTGAC Chr2:125657343..125657362 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:125670872..125670892 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATTCAAAGCGCTAAAACA Chr2:125670966..125670986 58.04 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027206