Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12103
Trapped Gene
G3bp1 (ENSMUSG00000018583)
Vector Insertion
Chr 11: 55311544 - 55312059
Public Clones A053F01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000102559 (Chr11:55311415..55311543 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000102559 (Chr11:55311415..55311543 +)
Downstram Exon
ENSMUSE00000512180 (Chr11:55312060..55312169 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653304 Chr11:55283187..55283303 No primer for this exon
upstream ENSMUSE00000307184 Chr11:55299128..55299240 No primer for this exon
upstream ENSMUSE00000488085 Chr11:55300981..55301062 No primer for this exon
upstream ENSMUSE00000102563 Chr11:55302521..55302694 No primer for this exon
upstream ENSMUSE00000102566 Chr11:55305466..55305556 No primer for this exon
upstream ENSMUSE00000102545 Chr11:55306950..55307043 No primer for this exon
upstream ENSMUSE00000307157 Chr11:55308755..55308953 No primer for this exon
upstream ENSMUSE00000102555 Chr11:55309646..55309747 No primer for this exon
upstream ENSMUSE00000102548 Chr11:55311153..55311264 No primer for this exon
upstream ENSMUSE00000102559 Chr11:55311415..55311543 No primer for this exon

*** Putative Vector Insertion (Chr 11: 55311544 - 55312059) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000512180 Chr11:55312060..55312169 No primer for this exon
downstream ENSMUSE00000414482 Chr11:55312961..55314013 No primer for this exon
downstream ENSMUSE00000653300 Chr11:55312961..55314013 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr11:55311593..55311613 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000018583