Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12113
Trapped Gene
Itga1 (ENSMUSG00000042284)
Vector Insertion
Chr 13: 115787272 - 115791746
Public Clones G022B11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609862 (Chr13:115791747..115791891 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGAACGGAACTGTGGTC Chr13:115791838..115791857 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609862 (Chr13:115791747..115791891 -)
Downstram Exon
ENSMUSE00000609861 (Chr13:115787129..115787271 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGAACGGAACTGTGGTC Chr13:115791838..115791857 60.01 55 CCCAGCGATATAGAGCACATC Chr13:115787197..115787217 59.71 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000609872 Chr13:115891679..115892172 AAGATCGCCCTCTCAGTGAA Chr13:115892134..115892153 59.95 50
upstream ENSMUSE00000639616 Chr13:115839491..115839611 CTAGGCGTCTGCATCTCCTT Chr13:115839587..115839606 59.6 55
upstream ENSMUSE00000639614 Chr13:115825481..115825593 CAACCCAAAGCAAGAACTGG Chr13:115825546..115825565 60.66 50
upstream ENSMUSE00000639612 Chr13:115821313..115821401 ATCCGAAGGGAGGATTTCTG Chr13:115821313..115821332 60.4 50
upstream ENSMUSE00000639609 Chr13:115821091..115821202 GTGGGCCCTTGTATGCCTAT Chr13:115821179..115821198 61.09 55
upstream ENSMUSE00000639608 Chr13:115820244..115820371 ATCGTCCTAGATGGCTCCAA Chr13:115820326..115820345 59.65 50
upstream ENSMUSE00000639607 Chr13:115806320..115806468 GTGGTCTCCAGACGATGACA Chr13:115806343..115806362 59.67 55
upstream ENSMUSE00000639606 Chr13:115802368..115802518 ATCGCCTGAAACAGGTCATC Chr13:115802410..115802429 60.08 50
upstream ENSMUSE00000639590 Chr13:115799886..115799921 ACAAGCTACCAGACCCTTGG Chr13:115799890..115799909 59.21 55
upstream ENSMUSE00000609864 Chr13:115797112..115797277 CCGAAAAATTTGTGGAGGAG Chr13:115797224..115797243 59.54 45
upstream ENSMUSE00000609863 Chr13:115792458..115792531 CAGTCAGCAGCTTCGTTTGA Chr13:115792501..115792520 60.32 50
upstream ENSMUSE00000609862 Chr13:115791747..115791891 ACTGGAACGGAACTGTGGTC Chr13:115791838..115791857 60.01 55

*** Putative Vector Insertion (Chr 13: 115787272 - 115791746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609861 Chr13:115787129..115787271 CCCAGCGATATAGAGCACATC Chr13:115787197..115787217 59.71 52.38
downstream ENSMUSE00000609860 Chr13:115784002..115784145 ACGTACACCTTGCCCTGTTC Chr13:115783996..115784015 60.03 55
downstream ENSMUSE00000609859 Chr13:115782475..115782732 CCATCCACGTTGAGGTCTTT Chr13:115782556..115782575 59.97 50
downstream ENSMUSE00000609858 Chr13:115780268..115780398 ACCATCGCCATTTAAATCCA Chr13:115780293..115780312 60.15 40
downstream ENSMUSE00000609857 Chr13:115777811..115777977 CTCCACACGGCAGTTTTTCT Chr13:115777871..115777890 60.29 50
downstream ENSMUSE00000609856 Chr13:115776338..115776474 TTCTCGAACGGTGAGGTTTC Chr13:115776349..115776368 60.23 50
downstream ENSMUSE00000609855 Chr13:115775280..115775390 CACGGAGTCCTGAAAGTCGT Chr13:115775342..115775361 60.3 55
downstream ENSMUSE00000609854 Chr13:115772940..115773149 TGTACGCACTGTCTCCCTTG Chr13:115772971..115772990 59.9 55
downstream ENSMUSE00000609853 Chr13:115770981..115771061 TTTGATTGGATTCGCAGCTA Chr13:115771006..115771025 59.4 40
downstream ENSMUSE00000609852 Chr13:115767808..115767884 TGCATTTTCTGAGAGATGTGATG Chr13:115767809..115767831 60.26 39.13
downstream ENSMUSE00000609851 Chr13:115765806..115765895 AGAGATTCCAGGGGCTCTTC Chr13:115765847..115765866 59.78 55
downstream ENSMUSE00000609850 Chr13:115764301..115764403 ATGTGGTGTTCACTCGCAGA Chr13:115764361..115764380 60.32 50
downstream ENSMUSE00000609849 Chr13:115760687..115760800 TGACCATCCAGTTGGGTACA Chr13:115760674..115760693 59.81 50
downstream ENSMUSE00000609848 Chr13:115758665..115758769 CTGGATTGTGCCTCTTTTGAG Chr13:115758643..115758663 59.86 47.62
downstream ENSMUSE00000120661 Chr13:115758412..115758516 TGACTCACATCCGAGGGAAG Chr13:115758433..115758452 61.22 55
downstream ENSMUSE00000361486 Chr13:115756724..115756816 TGAAGTTCTCCCCGTATGGT Chr13:115756751..115756770 59.4 50
downstream ENSMUSE00000351264 Chr13:115755806..115755922 AAGGCGCTCAGGAGGATAAC Chr13:115755830..115755849 60.73 55
downstream ENSMUSE00000609847 Chr13:115750287..115750342 TGGCCTTTTGAAGAATCCAA Chr13:115750300..115750319 60.56 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTAAGGAATGGGTGAAA Chr13:115791728..115791748 60.16 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTAAGGAATGGGTGAAA Chr13:115791728..115791748 60.16 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042284