Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12117
Trapped Gene
Pdap1 (ENSMUSG00000029623)
Vector Insertion
Chr 5: 145891245 - 145892233
Public Clones A061E06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000190822 (Chr5:145892234..145892385 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTGGCTGGGAAGACAGAG Chr5:145892319..145892338 59.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000190822 (Chr5:145892234..145892385 -)
Downstram Exon
ENSMUSE00000361483 (Chr5:145890526..145891244 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTGGCTGGGAAGACAGAG Chr5:145892319..145892338 59.28 50 GCGTGCAATCTACTGGACAA Chr5:145890822..145890841 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684841 Chr5:145900836..145900888 AGCCGAGATGCCTAAAGGAG Chr5:145900836..145900855 60.86 55
upstream ENSMUSE00000407837 Chr5:145897771..145897862 AGATCGATGCCCAGCTACAG Chr5:145897792..145897811 60.38 55
upstream ENSMUSE00000190824 Chr5:145895934..145896041 No primer for this exon
upstream ENSMUSE00000190823 Chr5:145893728..145893849 AAGAAGGTCACGCAACTGGA Chr5:145893764..145893783 60.83 50
upstream ENSMUSE00000190822 Chr5:145892234..145892385 ATTTGGCTGGGAAGACAGAG Chr5:145892319..145892338 59.28 50

*** Putative Vector Insertion (Chr 5: 145891245 - 145892233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361483 Chr5:145890526..145891244 GCGTGCAATCTACTGGACAA Chr5:145890822..145890841 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029623