Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1212
Trapped Gene
Lars2 (ENSMUSG00000035202)
Vector Insertion
Chr 9: 123286948 - 123301900
Public Clones CE0076 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252624 (Chr9:123286819..123286947 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCTACACCCTCAGCGACA Chr9:123286893..123286912 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252624 (Chr9:123286819..123286947 +)
Downstram Exon
ENSMUSE00000252606 (Chr9:123301901..123301992 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCTACACCCTCAGCGACA Chr9:123286893..123286912 60.46 55 TTTCAGGGTGCAAATTCCTC Chr9:123301982..123302001 60.05 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000252675 Chr9:123276054..123276225 TGGGTCTTGCTCGTGTAATG Chr9:123276092..123276111 59.72 50
upstream ENSMUSE00000252643 Chr9:123280973..123281221 GTTAGCAGGCCACCTGTCAT Chr9:123281048..123281067 60.14 55
upstream ENSMUSE00000252624 Chr9:123286819..123286947 TGTCTACACCCTCAGCGACA Chr9:123286893..123286912 60.46 55

*** Putative Vector Insertion (Chr 9: 123286948 - 123301900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252606 Chr9:123301901..123301992 TTTCAGGGTGCAAATTCCTC Chr9:123301982..123302001 60.05 45
downstream ENSMUSE00000498155 Chr9:123304069..123304129 GTCGAGCTGCTTCCTCATGT Chr9:123304102..123304121 60.56 55
downstream ENSMUSE00000252559 Chr9:123318732..123318821 TTGATAGGCCAGTCCTGCTT Chr9:123318818..123318837 59.84 50
downstream ENSMUSE00000252543 Chr9:123320991..123321134 TGGATCCCAGTTAACCAAGG Chr9:123321014..123321033 59.78 50
downstream ENSMUSE00000252522 Chr9:123327297..123327404 CATGCCTTTGATTCCGTACC Chr9:123327353..123327372 60.33 50
downstream ENSMUSE00000252498 Chr9:123327753..123327912 CAGAGCTGCAGCCATGTAGA Chr9:123327876..123327895 60.31 55
downstream ENSMUSE00000252474 Chr9:123336565..123336669 CATGATAACGATGGGGACCT Chr9:123336632..123336651 59.63 50
downstream ENSMUSE00000252455 Chr9:123341004..123341119 GAGTAGGGTAGGCCCAGAGC Chr9:123341067..123341086 60.23 65
downstream ENSMUSE00000252428 Chr9:123345235..123345518 TCCTCTGCCCGTTAAAGATG Chr9:123345471..123345490 60.21 50
downstream ENSMUSE00000252414 Chr9:123347253..123347351 TACCACGCAGAATCCACAAA Chr9:123347318..123347337 60.11 45
downstream ENSMUSE00000252399 Chr9:123350582..123350719 GTCGTGGCAAAAATGACTGA Chr9:123350702..123350721 59.7 45
downstream ENSMUSE00000252389 Chr9:123361863..123361963 TGTCCCTTAATGAGGCCTTG Chr9:123361910..123361929 60.07 50
downstream ENSMUSE00000252367 Chr9:123362329..123362511 GGGCTGCAAAGAGGATGTAG Chr9:123362481..123362500 59.84 55
downstream ENSMUSE00000252345 Chr9:123363828..123363997 TGCCTCGATGAATCTTGTTG Chr9:123363901..123363920 59.8 45
downstream ENSMUSE00000252314 Chr9:123364078..123364155 TGAGTCCCATCAGCTGAGAA Chr9:123364144..123364163 59.5 50
downstream ENSMUSE00000252287 Chr9:123365011..123365122 AGGGCACACAGAGCATCTTC Chr9:123365072..123365091 60.42 55
downstream ENSMUSE00000252264 Chr9:123368610..123368737 AATCCCAGGCATAATGGTCA Chr9:123368660..123368679 60.15 45
downstream ENSMUSE00000252250 Chr9:123370617..123371780 GGGCCTGTGATGGTAAAAGA Chr9:123371347..123371366 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACGGTTCCAGAAAATGAG Chr9:123298919..123298939 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACGGTTCCAGAAAATGAG Chr9:123298919..123298939 60.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035202