Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12124
Trapped Gene
Zfp652 (ENSMUSG00000075595)
Vector Insertion
Chr 11: 95615370 - 95624852
Public Clones A055B01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674204 (Chr11:95615225..95615369 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGACGAGCACATGAAGA Chr11:95615341..95615360 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674204 (Chr11:95615225..95615369 +)
Downstram Exon
ENSMUSE00000674203 (Chr11:95624853..95626025 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGACGAGCACATGAAGA Chr11:95615341..95615360 60.14 50 CACCAAAAGCTGAACCGAAT Chr11:95625787..95625806 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674202 Chr11:95573987..95574047 No primer for this exon
upstream ENSMUSE00000674201 Chr11:95610314..95611461 CCGTAGGAAAAGTGCAGAGC Chr11:95611197..95611216 60.01 55
upstream ENSMUSE00000268212 Chr11:95610381..95611461 CCGTAGGAAAAGTGCAGAGC Chr11:95611197..95611216 60.01 55
upstream ENSMUSE00000674206 Chr11:95614189..95614336 CCATGGCTCATGTACGAAAA Chr11:95614307..95614326 59.54 45
upstream ENSMUSE00000674205 Chr11:95614676..95614791 TGTCACTCAAGGTGCACTCC Chr11:95614736..95614755 59.87 55
upstream ENSMUSE00000674204 Chr11:95615225..95615369 CTTCGACGAGCACATGAAGA Chr11:95615341..95615360 60.14 50

*** Putative Vector Insertion (Chr 11: 95615370 - 95624852) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674200 Chr11:95624853..95633667 CTCCGCAGTGGAGTTCTTTC Chr11:95629170..95629189 59.99 55
downstream ENSMUSE00000674203 Chr11:95624853..95626025 CACCAAAAGCTGAACCGAAT Chr11:95625787..95625806 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCGCTGTGGGTTCTATGT Chr11:95621349..95621369 59.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCGCTGTGGGTTCTATGT Chr11:95621349..95621369 59.76 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075595