Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12160
Trapped Gene
Stmn2 (ENSMUSG00000027500)
Vector Insertion
Chr 3: 8509520 - 8509631
Public Clones W255B05 (ggtc) Ayu21-T264 (egtc) (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000382200 (Chr3:8509521..8509630 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCTGGACCCTTCTCCTT Chr3:8509555..8509574 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000382200 (Chr3:8509521..8509630 +)
Downstram Exon
ENSMUSE00000705955 (Chr3:8509565..8509630 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCTGGACCCTTCTCCTT Chr3:8509555..8509574 60.25 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 3: 8509520 - 8509631) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000382200 Chr3:8509521..8509630 TTAGCCATTGTAGGGATGTGC Chr3:8509621..8509641 59.97 47.62
downstream ENSMUSE00000705955 Chr3:8509565..8509630 No primer for this exon
downstream ENSMUSE00000311839 Chr3:8541841..8541936 GCAGGAGCAGATCAGTGACA Chr3:8541896..8541915 60.15 55
downstream ENSMUSE00000170117 Chr3:8545573..8545745 GGTGGCTTCAAGATCAGCTC Chr3:8545642..8545661 59.96 55
downstream ENSMUSE00000569583 Chr3:8554792..8554983 TTTCCTGCAGACGTTCAATG Chr3:8554984..8555003 59.84 45
downstream ENSMUSE00000170122 Chr3:8560266..8561604 TAATGCAGCAACCAGCTCAC Chr3:8561280..8561299 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAGCACGGTCCCACTCT Chr3:8509488..8509508 59.47 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTAGCACGGTCCCACTCT Chr3:8509488..8509508 59.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AATTAATCGCCTTGCAGCAC Chr3:8509612..8509632 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000027500