Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12166
Trapped Gene
4933424B01Rik (ENSMUSG00000040250)
Vector Insertion
Chr 6: 146524983 - 146525822
Public Clones (sanger) W227C03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000462507 (Chr6:146525823..146526281 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTCCCTACGGTTGATTGG Chr6:146526140..146526159 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000462507 (Chr6:146525823..146526281 -)
Downstram Exon
ENSMUSE00000376875 (Chr6:146524747..146524982 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTCCCTACGGTTGATTGG Chr6:146526140..146526159 59.93 50 CAAACTCCACATGCTGCCTA Chr6:146524859..146524878 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462507 Chr6:146525823..146526281 TCTTCCCTACGGTTGATTGG Chr6:146526140..146526159 59.93 50

*** Putative Vector Insertion (Chr 6: 146524983 - 146525822) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000376875 Chr6:146524747..146524982 CAAACTCCACATGCTGCCTA Chr6:146524859..146524878 59.86 50
downstream ENSMUSE00000345730 Chr6:146523224..146523298 AAAACATGTGCTCCCGAATC Chr6:146523239..146523258 59.94 45
downstream ENSMUSE00000374892 Chr6:146515015..146515217 CCCAACTCGTTCTGCATTCT Chr6:146515031..146515050 60.26 50
downstream ENSMUSE00000334923 Chr6:146514150..146514230 CTGGACACAATCTTCGAGCA Chr6:146514172..146514191 59.98 50
downstream ENSMUSE00000387669 Chr6:146511949..146512039 CACCAACTGGGTAGGTGTGA Chr6:146511962..146511981 59.44 55
downstream ENSMUSE00000197104 Chr6:146510251..146510379 AGCTCGGACACTGTGGACTT Chr6:146510316..146510335 59.91 55
downstream ENSMUSE00000197089 Chr6:146508648..146508732 TCCACGTCATAGTTGGCAGA Chr6:146508670..146508689 60.26 50
downstream ENSMUSE00000197112 Chr6:146506055..146506144 TGTGCACCACTTCAGGGTTA Chr6:146506052..146506071 60.15 50
downstream ENSMUSE00000353862 Chr6:146505773..146505862 CCACAGGTGAAATCCGGTAA Chr6:146505799..146505818 60.74 50
downstream ENSMUSE00000197122 Chr6:146504653..146504831 GGCTGCTAAGCATGTGACTG Chr6:146504741..146504760 59.62 55
downstream ENSMUSE00000197120 Chr6:146503450..146503620 CCAGTAACGGGTGTGCTTTT Chr6:146503470..146503489 60.03 50
downstream ENSMUSE00000412261 Chr6:146503014..146503168 CCTTTCCTCTGGTACCGACT Chr6:146503002..146503021 58.26 55
downstream ENSMUSE00000197102 Chr6:146502506..146502736 TCATTCCACATGATCCGGTA Chr6:146502685..146502704 59.73 45
downstream ENSMUSE00000197118 Chr6:146500894..146501033 TGGTGTCTCATCCGTTTCAA Chr6:146500891..146500910 60.09 45
downstream ENSMUSE00000197116 Chr6:146499161..146499296 AACTCCTGGTGCTTTCTGGA Chr6:146499205..146499224 59.84 50
downstream ENSMUSE00000197114 Chr6:146498609..146498686 TCCTCCAGTCAGTCCAACCT Chr6:146498640..146498659 59.68 55
downstream ENSMUSE00000373055 Chr6:146498156..146498507 CATTTCCAGAGGGAACACCT Chr6:146498196..146498215 58.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCTCAGCCTCCGTTCATT Chr6:146525843..146525863 59.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTCAGCCTCCGTTCATT Chr6:146525843..146525863 59.95 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGCCTGTCTAATCGCCTTG Chr6:146526220..146526240 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGTCCGTGACTGGGAAAAC Chr6:146526216..146526236 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040250