Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12168
Trapped Gene
Zfhx2 (ENSMUSG00000040721)
Vector Insertion
Chr 14: 55694122 - 55710844
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (ggtc) E119A12 (ggtc) D136E11 (ggtc) (ggtc)
P145D02 (ggtc) D174F01 (ggtc) D053D10 (ggtc) P093B11 (ggtc) D171A09 (ggtc)
D026F05 (ggtc) (ggtc) W207D04 (ggtc) E119A11 (ggtc) D136E11 (ggtc)
Q010D08 (ggtc) (ggtc) P145D02 (ggtc) D174F01 (ggtc) D053D10 (ggtc)
(ggtc) P093B11 (ggtc) D147E12 (ggtc) D021E10 (ggtc) (ggtc)
D179H11 (ggtc) D070G09 (ggtc) 3SE142G01 (ggtc) P093B12 (ggtc) D171A09 (ggtc)
D029C12 (ggtc) PST18468-NR (escells) PST1707-1 (escells) IST12474F10 (tigm)
IST14159C3 (tigm) IST10456H1 (tigm) IST10688D12 (tigm) IST12692F2 (tigm)
IST14163C9 (tigm) IST11931F1 (tigm) IST14515E5 (tigm) IST10164D9 (tigm)
IST14164H3 (tigm) IST12009D9 (tigm) IST14457D2 (tigm) IST10092B9 (tigm)
IST13200E12 (tigm) IST10895C10 (tigm) IST10246G10 (tigm) IST10456H1 (tigm)
IST10130H9 (tigm) IST10909C10 (tigm) IST11205C11 (tigm) IST11931F1 (tigm)
IST12755F2 (tigm) IST12546E8 (tigm) IST14676C8 (tigm) IST11689C2 (tigm)
IST14578H11 (tigm) IST14734G1 (tigm) IST14790H7 (tigm) IST11585E1 (tigm)
IST12009D9 (tigm) IST12951F12 (tigm) IST14132C2 (tigm) IST10348E7 (tigm)
IST13549E10 (tigm) IST14192D6 (tigm) IST14734G1 (tigm)
Private Clones OST456647 (lexicon) OST422742 (lexicon) OST368354 (lexicon) OST316454 (lexicon)
OST314478 (lexicon) OST284064 (lexicon) OST252915 (lexicon) OST242525 (lexicon)
OST241131 (lexicon) OST193743 (lexicon) OST191409 (lexicon) OST176004 (lexicon)
OST161025 (lexicon) OST148007 (lexicon) OST135898 (lexicon) OST132046 (lexicon)
OST127467 (lexicon) OST114589 (lexicon) OST90103 (lexicon) OST82810 (lexicon)
OST77760 (lexicon) OST31057 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648718 (Chr14:55710845..55710885 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648718 (Chr14:55710845..55710885 -)
Downstram Exon
ENSMUSE00000616120 (Chr14:55692050..55694121 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGAGGTATCGTGGGACAACA Chr14:55693493..55693512 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648718 Chr14:55710845..55710885 No primer for this exon

*** Putative Vector Insertion (Chr 14: 55694122 - 55710844) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000616120 Chr14:55692050..55694121 TGAGGTATCGTGGGACAACA Chr14:55693493..55693512 59.96 50
downstream ENSMUSE00000648717 Chr14:55691384..55691901 TGTGTTTGTCGGTCTTGAGG Chr14:55691574..55691593 59.72 50
downstream ENSMUSE00000648716 Chr14:55690696..55690936 GCACAACAGGCAGTGGTAAA Chr14:55690849..55690868 59.76 50
downstream ENSMUSE00000648715 Chr14:55689398..55689472 No primer for this exon
downstream ENSMUSE00000648714 Chr14:55688976..55689034 TCTGGTTGGCACTATCTCTGG Chr14:55688959..55688979 60.26 52.38
downstream ENSMUSE00000648713 Chr14:55686945..55687145 ACCCTCACCTGGTCACACTC Chr14:55687068..55687087 60.01 60
downstream ENSMUSE00000648712 Chr14:55686322..55686448 ATTTTGGTTGCGAAGGTCAT Chr14:55686392..55686411 59.43 40
downstream ENSMUSE00000454262 Chr14:55682642..55686118 CAGTCTCGCCTTCCTTGAAC Chr14:55685458..55685477 59.99 55
downstream ENSMUSE00000319241 Chr14:55680498..55682408 AGCCTCCCGTTTGGTTAGTT Chr14:55680917..55680936 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGCTTGAGTTCTGCCAAC Chr14:55698821..55698841 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTATCAGCTGCGTGACTG Chr14:55698785..55698805 59.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAAAGCTCACCCACCTCTA Chr14:55698903..55698923 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAAAGCTCACCCACCTCTA Chr14:55698903..55698923 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040721