Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12182
Trapped Gene
Zfp574 (ENSMUSG00000045252)
Vector Insertion
Chr 7: 25862406 - 25864553
Public Clones W257E04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000440002 (Chr7:25862319..25862405 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAGAGTGGCGGTGCAAAGG Chr7:25862337..25862356 63.15 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000440002 (Chr7:25862319..25862405 +)
Downstram Exon
ENSMUSE00000482180 (Chr7:25864554..25867499 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAGAGTGGCGGTGCAAAGG Chr7:25862337..25862356 63.15 60 TACCAAACTCCCGGCTACAC Chr7:25866014..25866033 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440002 Chr7:25862319..25862405 CTAGAGTGGCGGTGCAAAGG Chr7:25862337..25862356 63.15 60

*** Putative Vector Insertion (Chr 7: 25862406 - 25864553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482180 Chr7:25864554..25867499 TACCAAACTCCCGGCTACAC Chr7:25866014..25866033 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr7:25862456..25862476 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000045252