Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12184
Trapped Gene
Wtap (ENSMUSG00000060475)
Vector Insertion
Chr 17: 13178820 - 13184942
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) P148G07 (ggtc) P125F08 (ggtc) P107D07 (ggtc)
E080D06 (ggtc) D035D02 (ggtc) P148C03 (ggtc) P117H02 (ggtc) P094B02 (ggtc)
D107B02 (ggtc) D015D09 (ggtc) 5SE286B12 (ggtc) P134A08 (ggtc) P115B06 (ggtc)
H002A02 (ggtc) D039G06 (ggtc) D006E03 (ggtc) P148G06 (ggtc) P118F02 (ggtc)
P099F07 (ggtc) D178A02 (ggtc) D029C10 (ggtc) W238D05 (ggtc) P148C03 (ggtc)
P117F11 (ggtc) P094B02 (ggtc) D048H06 (ggtc) D008B11 (ggtc) 3SE307F05 (ggtc)
P148G07 (ggtc) P125F08 (ggtc) P107D07 (ggtc) E086F04 (ggtc) D037H05 (ggtc)
P148G06 (ggtc) P117H02 (ggtc) P099F07 (ggtc) D107B02 (ggtc) D025H03 (ggtc)
(ggtc) P139A09 (ggtc) P115B06 (ggtc) P093C03 (ggtc) D040C04 (ggtc)
D006E03 (ggtc) 3SE307B06 (ggtc) PST14506-NL (escells) PST8713-NL (escells)
PST21088-NR (escells) PST17751-NR (escells) PST11837-NR (escells) PST4223-NL (escells)
PST22352-NR (escells) PST18 (escells) PST11233-NR (escells) PST22312-NL (escells)
PST17887-NL (escells) PST12569-NL (escells) PST6639-NR (escells) PST22079-NR (escells)
PST17235-NR (escells) PST5540-NR (escells) PST543-1 (escells) PST19197-NR (escells)
PST4926-NR (escells) PST0006-NL (escells) PST22169-NL (escells) PST17788-NR (escells)
PST11877-NL (escells) PST5079-NL (escells) PST21966-NR (escells) PST12527-NR (escells)
PST3363-NL (escells) PST1282-2 (escells) PST18107-NR (escells) PSTVU02.52B (vanderbilt)
IST15001D10 (tigm) IST10931F5 (tigm) IST14114A4 (tigm) IST10074D11 (tigm)
Private Clones OST461911 (lexicon) OST415126 (lexicon) OST406652 (lexicon) OST405307 (lexicon)
OST345691 (lexicon) OST323759 (lexicon) OST310407 (lexicon) OST274626 (lexicon)
OST272006 (lexicon) OST234732 (lexicon) OST225995 (lexicon) OST223142 (lexicon)
OST215818 (lexicon) OST193528 (lexicon) OST176901 (lexicon) OST158171 (lexicon)
OST149144 (lexicon) OST125951 (lexicon) OST102868 (lexicon) OST100556 (lexicon)
OST85385 (lexicon) OST39932 (lexicon) OST33748 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703761 (Chr17:13184943..13185021 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703761 (Chr17:13184943..13185021 -)
Downstram Exon
ENSMUSE00000555871 (Chr17:13178782..13178819 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTCGTTGGTCATCTTGCAC Chr17:13178777..13178796 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703761 Chr17:13184943..13185021 No primer for this exon

*** Putative Vector Insertion (Chr 17: 13178820 - 13184942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555871 Chr17:13178782..13178819 CTTCGTTGGTCATCTTGCAC Chr17:13178777..13178796 59.29 50
downstream ENSMUSE00000243365 Chr17:13176323..13176378 ATCCCGTGCCATAACTTTGA Chr17:13176315..13176334 60.33 45
downstream ENSMUSE00000135725 Chr17:13174616..13174674 TCCCTCCAAAGCTTGAACAT Chr17:13174613..13174632 59.67 45
downstream ENSMUSE00000135728 Chr17:13173688..13173815 TCTCCTGCTCTTTGGTTGCT Chr17:13173680..13173699 60.13 50
downstream ENSMUSE00000464217 Chr17:13168162..13168340 CATTTTGGGCTTGTTCCAGT Chr17:13168171..13168190 59.97 45
downstream ENSMUSE00000135730 Chr17:13162271..13162425 CATTCGACACTTCGCCATTA Chr17:13162367..13162386 59.69 45
downstream ENSMUSE00000483745 Chr17:13159669..13160917 ACTTGGTCCATTTGCCAGAC Chr17:13160669..13160688 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACTTCAGCACTGCCAGACG Chr17:13181938..13181958 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCGTGACTGGGAAAACC Chr17:13181875..13181895 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr17:13178951..13178971 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGTTGAATCCCTCGTGACT Chr17:13184964..13184984 58.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060475