Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12187
Trapped Gene
Cct3 (ENSMUSG00000001416)
Vector Insertion
Chr 3: 88117297 - 88117477
Public Clones W269D03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175680 (Chr3:88117164..88117296 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175680 (Chr3:88117164..88117296 +)
Downstram Exon
ENSMUSE00000292867 (Chr3:88117478..88117559 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000360495 Chr3:88101061..88101188 No primer for this exon
upstream ENSMUSE00000175674 Chr3:88103264..88103325 No primer for this exon
upstream ENSMUSE00000175685 Chr3:88104722..88104772 No primer for this exon
upstream ENSMUSE00000175681 Chr3:88104851..88104913 No primer for this exon
upstream ENSMUSE00000175675 Chr3:88106690..88106786 No primer for this exon
upstream ENSMUSE00000175678 Chr3:88108935..88109052 No primer for this exon
upstream ENSMUSE00000175683 Chr3:88113083..88113269 No primer for this exon
upstream ENSMUSE00000175677 Chr3:88115595..88115744 No primer for this exon
upstream ENSMUSE00000175680 Chr3:88117164..88117296 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88117297 - 88117477) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292867 Chr3:88117478..88117559 No primer for this exon
downstream ENSMUSE00000175682 Chr3:88122268..88122448 No primer for this exon
downstream ENSMUSE00000175673 Chr3:88124382..88124627 No primer for this exon
downstream ENSMUSE00000175679 Chr3:88124936..88125067 No primer for this exon
downstream ENSMUSE00000175676 Chr3:88125366..88125688 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGGGCGCTGTCAGTTCTC Chr3:88117298..88117318 60.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGGGCGCTGTCAGTTCTC Chr3:88117298..88117318 60.02 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001416