Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12204
Trapped Gene
Rad51ap1 (ENSMUSG00000030346)
Vector Insertion
Chr 6: 126877555 - 126877706
Public Clones A054E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690810 (Chr6:126877556..126877705 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGAGTGTTGAAGGGGAGAG Chr6:126877654..126877673 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690810 (Chr6:126877556..126877705 -)
Downstram Exon
ENSMUSE00000197672 (Chr6:126877556..126877708 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGAGTGTTGAAGGGGAGAG Chr6:126877654..126877673 60.38 55 GGCTTGAGATGGTGACTTCC Chr6:126877613..126877632 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690820 Chr6:126889512..126889605 No primer for this exon
upstream ENSMUSE00000690836 Chr6:126889512..126889573 No primer for this exon
upstream ENSMUSE00000408291 Chr6:126885971..126886026 No primer for this exon
upstream ENSMUSE00000197676 Chr6:126884732..126884867 ACCAACAGAACCCCCTAAAA Chr6:126884736..126884755 58.41 45
upstream ENSMUSE00000690829 Chr6:126884732..126884873 ACCAACAGAACCCCCTAAAA Chr6:126884736..126884755 58.41 45
upstream ENSMUSE00000197678 Chr6:126880011..126880120 CTTCCAACACTCACCAACCA Chr6:126880034..126880053 59.56 50
upstream ENSMUSE00000197675 Chr6:126878159..126878245 CGGGTAAACCTCCTCATGTC Chr6:126878190..126878209 59.4 55
upstream ENSMUSE00000197672 Chr6:126877556..126877708 TCGAGTGTTGAAGGGGAGAG Chr6:126877654..126877673 60.38 55
upstream ENSMUSE00000690810 Chr6:126877556..126877705 TCGAGTGTTGAAGGGGAGAG Chr6:126877654..126877673 60.38 55

*** Putative Vector Insertion (Chr 6: 126877555 - 126877706) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197674 Chr6:126876377..126876535 CTTTTCCCCTGCAGGTTTCT Chr6:126876392..126876411 60.6 50
downstream ENSMUSE00000197677 Chr6:126874936..126875085 CTGGTTTCCTAGTGGCCTCA Chr6:126874968..126874987 60.25 55
downstream ENSMUSE00000651290 Chr6:126873437..126874358 CCCGAGTGACAGTGGCTTAT Chr6:126873967..126873986 60.13 55
downstream ENSMUSE00000690816 Chr6:126873068..126874358 CCCGAGTGACAGTGGCTTAT Chr6:126873967..126873986 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGTTCGTGTCTCCAGAA Chr6:126877705..126877725 60.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGTTCGTGTCTCCAGAA Chr6:126877705..126877725 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030346