Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12214
Trapped Gene
Banp (ENSMUSG00000025316)
Vector Insertion
Chr 8: 124515427 - 124515604
Public Clones A052A01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605758 (Chr8:124515428..124515603 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGAAGCAACGTCACACTC Chr8:124515565..124515584 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605758 (Chr8:124515428..124515603 +)
Downstram Exon
ENSMUSE00000605764 (Chr8:124515428..124515603 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGAAGCAACGTCACACTC Chr8:124515565..124515584 59.88 50 GGGTGATGAGTGTGACGTTG Chr8:124515594..124515613 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477565 Chr8:124474447..124474548 CCGACAAACACCACGAGAAT Chr8:124474514..124474533 60.95 50
upstream ENSMUSE00000711374 Chr8:124498327..124498465 ACCGCATACCCTGTGACTTC Chr8:124498336..124498355 60 55
upstream ENSMUSE00000719259 Chr8:124498327..124498465 ACCGCATACCCTGTGACTTC Chr8:124498336..124498355 60 55
upstream ENSMUSE00000605760 Chr8:124499800..124499891 AATTGCCAGGACCCCTCTAT Chr8:124499868..124499887 59.79 50
upstream ENSMUSE00000605766 Chr8:124499800..124499891 AATTGCCAGGACCCCTCTAT Chr8:124499868..124499887 59.79 50
upstream ENSMUSE00000605759 Chr8:124502455..124502654 GTTTGCGGTTGGATAGCATT Chr8:124502486..124502505 59.97 45
upstream ENSMUSE00000605765 Chr8:124502455..124502654 GTTTGCGGTTGGATAGCATT Chr8:124502486..124502505 59.97 45
upstream ENSMUSE00000579685 Chr8:124513855..124513971 CTCAACAATGATCGGCAGAA Chr8:124513880..124513899 59.8 45
upstream ENSMUSE00000634005 Chr8:124513855..124513971 CTCAACAATGATCGGCAGAA Chr8:124513880..124513899 59.8 45

*** Putative Vector Insertion (Chr 8: 124515427 - 124515604) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605758 Chr8:124515428..124515603 GGGTGATGAGTGTGACGTTG Chr8:124515594..124515613 60.01 55
downstream ENSMUSE00000605764 Chr8:124515428..124515603 GGGTGATGAGTGTGACGTTG Chr8:124515594..124515613 60.01 55
downstream ENSMUSE00000605757 Chr8:124520940..124521179 GATGTGCAACATGTCGGAAG Chr8:124521034..124521053 60.12 50
downstream ENSMUSE00000605763 Chr8:124520940..124521179 GATGTGCAACATGTCGGAAG Chr8:124521034..124521053 60.12 50
downstream ENSMUSE00000579681 Chr8:124524864..124525031 GCTCTGCTTGATCCGATACC Chr8:124524925..124524944 59.8 55
downstream ENSMUSE00000579677 Chr8:124529452..124529582 ATCTGGTGGATCTGGACCTG Chr8:124529560..124529579 59.92 55
downstream ENSMUSE00000149661 Chr8:124530991..124531062 TCCTGTGTGATCTGCACCTG Chr8:124531058..124531077 60.9 55
downstream ENSMUSE00000149660 Chr8:124531653..124531691 GACCCACATGATGGATCTGC Chr8:124531683..124531702 61.34 55
downstream ENSMUSE00000149654 Chr8:124544419..124544544 GAGTCACCGCTGACAGGAAT Chr8:124544465..124544484 60.27 55
downstream ENSMUSE00000149658 Chr8:124547903..124548046 GGAGAGGCGACCCATCTACT Chr8:124547981..124548000 60.62 60
downstream ENSMUSE00000452776 Chr8:124549464..124549969 AGAACCTGCAGTTGCTTGCT Chr8:124549633..124549652 60.2 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACACCATCGTGGTGAAAG Chr8:124515450..124515470 58.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGTCGTGACTGGGAAAAC Chr8:124515473..124515493 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025316