Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12218
Trapped Gene
Ascc2 (ENSMUSG00000020412)
Vector Insertion
Chr 11: 4537826 - 4540385
Public Clones P102B04 (ggtc) D145D06 (ggtc) W244D01 (ggtc) D145D06 (ggtc) IST14623D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442602 (Chr11:4537766..4537825 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442602 (Chr11:4537766..4537825 +)
Downstram Exon
ENSMUSE00000442588 (Chr11:4540386..4540483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000442602 Chr11:4537766..4537825 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4537826 - 4540385) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000442588 Chr11:4540386..4540483 No primer for this exon
downstream ENSMUSE00000442592 Chr11:4546565..4546723 No primer for this exon
downstream ENSMUSE00000442584 Chr11:4547066..4547236 No primer for this exon
downstream ENSMUSE00000442578 Chr11:4549743..4549872 No primer for this exon
downstream ENSMUSE00000442575 Chr11:4556272..4556339 No primer for this exon
downstream ENSMUSE00000442571 Chr11:4558218..4558328 No primer for this exon
downstream ENSMUSE00000442568 Chr11:4559275..4559387 No primer for this exon
downstream ENSMUSE00000309653 Chr11:4564232..4564306 No primer for this exon
downstream ENSMUSE00000309646 Chr11:4568318..4568425 No primer for this exon
downstream ENSMUSE00000309639 Chr11:4568583..4568651 No primer for this exon
downstream ENSMUSE00000309630 Chr11:4568865..4568939 No primer for this exon
downstream ENSMUSE00000309621 Chr11:4570279..4570465 No primer for this exon
downstream ENSMUSE00000309613 Chr11:4572286..4572500 No primer for this exon
downstream ENSMUSE00000309603 Chr11:4573331..4573450 No primer for this exon
downstream ENSMUSE00000309594 Chr11:4579255..4579348 No primer for this exon
downstream ENSMUSE00000309586 Chr11:4579434..4579555 No primer for this exon
downstream ENSMUSE00000382487 Chr11:4580086..4580185 No primer for this exon
downstream ENSMUSE00000104307 Chr11:4581442..4581521 No primer for this exon
downstream ENSMUSE00000442270 Chr11:4582910..4583386 No primer for this exon
downstream ENSMUSE00000682142 Chr11:4582910..4583023 No primer for this exon
downstream ENSMUSE00000682141 Chr11:4585190..4585307 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGAGCCAGGACCTAATCG Chr11:4537863..4537883 61.12 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTGCAGCTGAACATCTCG Chr11:4537790..4537810 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020412