Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12220
Trapped Gene
Zwilch (ENSMUSG00000032400)
Vector Insertion
Chr 9: 63987824 - 63991886
Public Clones A039A02 (ggtc)
Private Clones OST348840 (lexicon) OST42808 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000347367 (Chr9:63991887..63991999 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCCTGTAGACCATTCCAG Chr9:63991901..63991920 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000347367 (Chr9:63991887..63991999 -)
Downstram Exon
ENSMUSE00000390139 (Chr9:63987698..63987823 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCCTGTAGACCATTCCAG Chr9:63991901..63991920 59.92 55 AACGAAGGCTGTCCTTTCTTC Chr9:63987749..63987769 59.88 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331328 Chr9:64020625..64020715 CGGAGGAGTTTTATGCTCGT Chr9:64020633..64020652 59.34 50
upstream ENSMUSE00000711185 Chr9:64020625..64020911 CGGAGGAGTTTTATGCTCGT Chr9:64020633..64020652 59.34 50
upstream ENSMUSE00000323062 Chr9:64016420..64016471 GGAGCCTCTAAAGACCCATTC Chr9:64016429..64016449 59.18 52.38
upstream ENSMUSE00000219417 Chr9:64013170..64013265 GTGCAGTTGATCAGCAAAGG Chr9:64013234..64013253 59.44 50
upstream ENSMUSE00000219419 Chr9:64012154..64012272 CCTTACCTGTTGGGAGAGCA Chr9:64012156..64012175 60.25 55
upstream ENSMUSE00000219421 Chr9:64010371..64010570 CCTGTTGGCTAGGAGCTGAG Chr9:64010429..64010448 60.15 60
upstream ENSMUSE00000219416 Chr9:64009178..64009248 No primer for this exon
upstream ENSMUSE00000219420 Chr9:64008628..64008783 TGTTGCCCCATCACAAACTA Chr9:64008705..64008724 59.96 45
upstream ENSMUSE00000322894 Chr9:64006502..64006573 No primer for this exon
upstream ENSMUSE00000322858 Chr9:64003820..64003913 ATGGCATCAGGACTGGTGTA Chr9:64003884..64003903 58.96 50
upstream ENSMUSE00000322833 Chr9:64002971..64003026 No primer for this exon
upstream ENSMUSE00000322801 Chr9:64001358..64001457 GGGATCTCGATTTTGCTGAA Chr9:64001383..64001402 60.15 45
upstream ENSMUSE00000362674 Chr9:64000692..64000771 CAGAGTCTTCAGCGTGGTGAT Chr9:64000704..64000724 60.46 52.38
upstream ENSMUSE00000322726 Chr9:63997963..63998119 CTCTGGAACTACCCCACTGC Chr9:63998023..63998042 59.72 60
upstream ENSMUSE00000399097 Chr9:63997206..63997234 No primer for this exon
upstream ENSMUSE00000322674 Chr9:63995077..63995213 GCCGTGTTCAGAAACTCCAT Chr9:63995151..63995170 60.12 50
upstream ENSMUSE00000400965 Chr9:63994632..63994727 TCAGTTGCCAGTCAGACCAG Chr9:63994657..63994676 60.02 55
upstream ENSMUSE00000347367 Chr9:63991887..63991999 TCCCCTGTAGACCATTCCAG Chr9:63991901..63991920 59.92 55

*** Putative Vector Insertion (Chr 9: 63987824 - 63991886) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390139 Chr9:63987698..63987823 AACGAAGGCTGTCCTTTCTTC Chr9:63987749..63987769 59.88 47.62
downstream ENSMUSE00000349645 Chr9:63985483..63985866 GGGATCTCCTCTCCACCTTC Chr9:63985710..63985729 60.01 60
downstream ENSMUSE00000720585 Chr9:63984951..63985866 CATGGCTCCAAAACTCCATT Chr9:63985440..63985459 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCCTGTAGACCATTCCA Chr9:63991900..63991920 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCCTGTAGACCATTCCA Chr9:63991900..63991920 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032400