Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12231
Trapped Gene
Ank3 (ENSMUSG00000069601)
Vector Insertion
Chr 10: 69462247 - 69464670
Public Clones A048C05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642789 (Chr10:69462103..69462246 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTCTGCTGGAAGGACCAA Chr10:69462152..69462171 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642789 (Chr10:69462103..69462246 +)
Downstram Exon
ENSMUSE00000642788 (Chr10:69464671..69465349 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTCTGCTGGAAGGACCAA Chr10:69462152..69462171 59.84 50 GGCCGGGTCTGTTACAGTTA Chr10:69464936..69464955 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521172 Chr10:68996970..68997032 CCAAGCCTGCTCATAGGAAG Chr10:68996998..68997017 59.97 55
upstream ENSMUSE00000612188 Chr10:69169222..69169673 CTGCCTCCACTACAGCCTCT Chr10:69169279..69169298 59.62 60
upstream ENSMUSE00000612180 Chr10:69271160..69271265 TAGTCTGATGCCAACGCAAG Chr10:69271161..69271180 60.01 50
upstream ENSMUSE00000375373 Chr10:69271164..69271265 TCTGATGCCAACGCAAGTTA Chr10:69271164..69271183 60.4 45
upstream ENSMUSE00000642824 Chr10:69271621..69271719 GCCATGTGGAAGTGGTCTCT Chr10:69271658..69271677 60.12 55
upstream ENSMUSE00000642823 Chr10:69271919..69272017 GTTACGAACGGAGCGAATGT Chr10:69271982..69272001 60.14 50
upstream ENSMUSE00000642822 Chr10:69278443..69278541 AACCACCTGGAAGTCGTCAG Chr10:69278479..69278498 60.15 55
upstream ENSMUSE00000288701 Chr10:69284956..69285141 GAGAACGACACGAAGGGAAA Chr10:69285022..69285041 60.23 50
upstream ENSMUSE00000288693 Chr10:69287066..69287164 GCCCACTATGGGAACATCAAT Chr10:69287093..69287113 60.96 47.62
upstream ENSMUSE00000288686 Chr10:69312854..69312952 AAGATCGATGCCAAGACCAG Chr10:69312932..69312951 60.22 50
upstream ENSMUSE00000642761 Chr10:69320968..69321024 TGAACAGTGGCACAATCAGG Chr10:69320972..69320991 60.72 50
upstream ENSMUSE00000575782 Chr10:69330133..69330231 GTCTGACTCCGTTGCACTGT Chr10:69330137..69330156 58.89 55
upstream ENSMUSE00000575781 Chr10:69333750..69333947 GACGACGTCACCAACGACTA Chr10:69333834..69333853 59.75 55
upstream ENSMUSE00000612185 Chr10:69337538..69337636 CGCATCCGAGTAATGGAACT Chr10:69337577..69337596 60.1 50
upstream ENSMUSE00000612184 Chr10:69340578..69340676 CCTTACCCCAATCCATGTTG Chr10:69340583..69340602 60.04 50
upstream ENSMUSE00000575778 Chr10:69342641..69342739 AAGTGGTGCGGTATCTGGTC Chr10:69342687..69342706 60 55
upstream ENSMUSE00000575777 Chr10:69345109..69345306 CCTGGATCATGGAGCATCTT Chr10:69345270..69345289 60.03 50
upstream ENSMUSE00000575775 Chr10:69347495..69347593 GCTTGAAGTCGCAAGTCTCC Chr10:69347536..69347555 60.14 55
upstream ENSMUSE00000575773 Chr10:69347887..69347985 GCAGCGCATTACGATAATCA Chr10:69347911..69347930 59.83 45
upstream ENSMUSE00000575772 Chr10:69355070..69355267 GAGTACGGTGCTGATGCAAA Chr10:69355136..69355155 59.87 50
upstream ENSMUSE00000575771 Chr10:69356193..69356291 GCTGCTCAAGAAGACCGAGT Chr10:69356217..69356236 59.75 55
upstream ENSMUSE00000575770 Chr10:69360789..69360887 CATGTGGGCTGTCACTATGG Chr10:69360807..69360826 59.98 55
upstream ENSMUSE00000575769 Chr10:69360976..69361074 GCCACACGCATATCATCAAT Chr10:69361013..69361032 59.38 45
upstream ENSMUSE00000288578 Chr10:69361742..69361837 ACATCTCGGTGGTTGACACA Chr10:69361782..69361801 60.01 50
upstream ENSMUSE00000349549 Chr10:69366946..69367018 TGTCCCAGAAACGATGAATG Chr10:69366972..69366991 59.5 45
upstream ENSMUSE00000403576 Chr10:69367196..69367258 AAAAGCTCAGTGATGGGGAAT Chr10:69367217..69367237 59.95 42.86
upstream ENSMUSE00000575767 Chr10:69383186..69383239 TGCACATGGTTCAAAATTCC Chr10:69383194..69383213 59.38 40
upstream ENSMUSE00000612178 Chr10:69388280..69388939 GGCTCTCTGGACTTGTGAGG Chr10:69388407..69388426 59.99 60
upstream ENSMUSE00000642814 Chr10:69390443..69390566 CATCACAGGGGACACTGACA Chr10:69390453..69390472 60.59 55
upstream ENSMUSE00000642809 Chr10:69395142..69395244 ACAGAAGCTCCTACGCAAGG Chr10:69395180..69395199 59.64 55
upstream ENSMUSE00000642808 Chr10:69413700..69413806 CTGACGTTCACGAGGGAGTT Chr10:69413703..69413722 60.3 55
upstream ENSMUSE00000642807 Chr10:69418674..69418898 GCTGGTAGAAATGGGTCCTG Chr10:69418860..69418879 59.55 55
upstream ENSMUSE00000642806 Chr10:69421666..69421820 CCTCATTTTGGGTCCATGAG Chr10:69421685..69421704 60.31 50
upstream ENSMUSE00000642805 Chr10:69436470..69436681 GTTGGGTACAAAGCGCATCT Chr10:69436489..69436508 60.14 50
upstream ENSMUSE00000642803 Chr10:69438796..69439003 GTGCCAGAGGAAACGGTAAA Chr10:69438805..69438824 60.11 50
upstream ENSMUSE00000642802 Chr10:69440461..69440557 TTCACAACCAACGTTTCAGC Chr10:69440535..69440554 59.74 45
upstream ENSMUSE00000642801 Chr10:69441219..69441447 CCTACATGGCCAAGTTCGTT Chr10:69441299..69441318 59.99 50
upstream ENSMUSE00000642799 Chr10:69442066..69442191 CCTCTGACCAAAGGAGGACA Chr10:69442114..69442133 60.23 55
upstream ENSMUSE00000642798 Chr10:69443020..69443142 AAGGGATTACCCCAAACAGC Chr10:69443083..69443102 60.19 50
upstream ENSMUSE00000612183 Chr10:69443572..69443598 No primer for this exon
upstream ENSMUSE00000642794 Chr10:69444864..69444945 CTTGACTGAACCCAGCATGA Chr10:69444926..69444945 59.83 50
upstream ENSMUSE00000612182 Chr10:69448837..69456510 CCCTCAGAACGAAACAGCTC Chr10:69454448..69454467 59.99 55
upstream ENSMUSE00000642792 Chr10:69457120..69457194 ATGGCGATAGTAGCCGATCA Chr10:69457155..69457174 60.59 50
upstream ENSMUSE00000642790 Chr10:69460843..69460974 GGTGACCAGAGACGGAAAGA Chr10:69460946..69460965 60.24 55
upstream ENSMUSE00000642789 Chr10:69462103..69462246 AACTCTGCTGGAAGGACCAA Chr10:69462152..69462171 59.84 50

*** Putative Vector Insertion (Chr 10: 69462247 - 69464670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642788 Chr10:69464671..69465349 GGCCGGGTCTGTTACAGTTA Chr10:69464936..69464955 59.99 55
downstream ENSMUSE00000464458 Chr10:69465259..69465349 TCATCCAGACGGTCCAGTAA Chr10:69465349..69465368 59.09 50
downstream ENSMUSE00000642778 Chr10:69467358..69467705 ACAGGCACACAGGGTTTAGG Chr10:69467651..69467670 60.03 55
downstream ENSMUSE00000642786 Chr10:69467358..69467739 ACAGGCACACAGGGTTTAGG Chr10:69467651..69467670 60.03 55
downstream ENSMUSE00000612181 Chr10:69478282..69478378 CCGGATTTCCTTCTTCGTCT Chr10:69478360..69478379 60.57 50
downstream ENSMUSE00000520253 Chr10:69478316..69478401 CCGGATTTCCTTCTTCGTCT Chr10:69478360..69478379 60.57 50
downstream ENSMUSE00000612179 Chr10:69486580..69490184 GTGTTTTCGGGAGAGAGCAG Chr10:69488262..69488281 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:69462297..69462317 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGTGACTGGGAAAAC Chr10:69462293..69462313 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069601