Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12242
Trapped Gene
AL805956.22 (ENSMUSG00000049494)
Vector Insertion
Chr 4: 91472880 - 91472881
Public Clones A050E06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369241 (Chr4:91472882..91473247 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCGACCGGTTAGATGGTG Chr4:91472938..91472957 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369241 (Chr4:91472882..91473247 -)
Downstram Exon
ENSMUSE00000394260 (Chr4:91472238..91472879 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCGACCGGTTAGATGGTG Chr4:91472938..91472957 59.99 55 GTCAGCTTTTTCAGGCGAAG Chr4:91472802..91472821 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369241 Chr4:91472882..91473247 AGTCGACCGGTTAGATGGTG Chr4:91472938..91472957 59.99 55

*** Putative Vector Insertion (Chr 4: 91472880 - 91472881) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394260 Chr4:91472238..91472879 GTCAGCTTTTTCAGGCGAAG Chr4:91472802..91472821 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTCTAGCGGAGCCTTTCG Chr4:91472878..91472898 62.35 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049494