Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12243
Trapped Gene
Gab1 (ENSMUSG00000031714)
Vector Insertion
Chr 8: 83315514 - 83323999
Public Clones A048E01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212304 (Chr8:83324000..83324294 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGTCCGTTGTATCTGTGA Chr8:83324029..83324048 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212304 (Chr8:83324000..83324294 -)
Downstram Exon
ENSMUSE00000212303 (Chr8:83315288..83315513 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGTCCGTTGTATCTGTGA Chr8:83324029..83324048 59.96 50 AGGTAGCGCGACTGAAGAAG Chr8:83315382..83315401 59.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387918 Chr8:83403431..83404395 CCGATCGAGTTCCTCTTCAG Chr8:83403688..83403707 59.94 55
upstream ENSMUSE00000212304 Chr8:83324000..83324294 TGGGTCCGTTGTATCTGTGA Chr8:83324029..83324048 59.96 50

*** Putative Vector Insertion (Chr 8: 83315514 - 83323999) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212303 Chr8:83315288..83315513 AGGTAGCGCGACTGAAGAAG Chr8:83315382..83315401 59.78 55
downstream ENSMUSE00000284348 Chr8:83312389..83312993 GTTGGCGGAATGTCGTAACT Chr8:83312630..83312649 60 50
downstream ENSMUSE00000284325 Chr8:83309000..83309085 GGTCCGTGGAATATCATAGCA Chr8:83309026..83309046 59.8 47.62
downstream ENSMUSE00000284305 Chr8:83308526..83308829 CTCTTCACCCGAGACACCTC Chr8:83308763..83308782 59.83 60
downstream ENSMUSE00000284290 Chr8:83298833..83298926 GCAGCTCTTCCCATTCTGAC Chr8:83298854..83298873 59.96 55
downstream ENSMUSE00000284274 Chr8:83298449..83298572 TTCGCCAGACAGATTTGGAT Chr8:83298433..83298452 60.6 45
downstream ENSMUSE00000284251 Chr8:83293550..83293672 TTTATTCATCGGGCTGCTTC Chr8:83293600..83293619 60.17 45
downstream ENSMUSE00000341346 Chr8:83288339..83290386 ATCCACACCAGACGATGTCA Chr8:83288869..83288888 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGAGGGAACTGTGCGTCT Chr8:83317977..83317997 59.91 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGAGGGAACTGTGCGTCT Chr8:83317977..83317997 59.91 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031714