Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12250
Trapped Gene
Phip (ENSMUSG00000032253)
Vector Insertion
Chr 9: 82765469 - 82768896
Public Clones A046E06 (ggtc)
Private Clones OST58755 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218139 (Chr9:82768897..82769094 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAAGTCAGCCGCAGTCATA Chr9:82768904..82768923 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218139 (Chr9:82768897..82769094 -)
Downstram Exon
ENSMUSE00000380837 (Chr9:82759766..82765468 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAAGTCAGCCGCAGTCATA Chr9:82768904..82768923 60.01 50 TTTCTGCCTCCACGACTCTT Chr9:82765131..82765150 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414720 Chr9:82868859..82869096 CATGTCTCGTGAGAGGAAAGG Chr9:82868879..82868899 59.85 52.38
upstream ENSMUSE00000368868 Chr9:82868695..82868753 AAGATGGACCCTGTCAGCAG Chr9:82868704..82868723 60.26 55
upstream ENSMUSE00000349745 Chr9:82868534..82868563 No primer for this exon
upstream ENSMUSE00000328622 Chr9:82868281..82868340 CCCCAGGACCTACCAGAATC Chr9:82868283..82868302 60.7 60
upstream ENSMUSE00000218128 Chr9:82853308..82853458 TCATCGGCTAGGACCTCTTC Chr9:82853392..82853411 59.39 55
upstream ENSMUSE00000218161 Chr9:82853119..82853217 CTACGGTAGCCCACCTAGCA Chr9:82853122..82853141 60.28 60
upstream ENSMUSE00000218166 Chr9:82839365..82839525 AACTGGCAGGCGGATATTTA Chr9:82839367..82839386 59.57 45
upstream ENSMUSE00000531480 Chr9:82826453..82826674 CTTCGAACCTGTGCACCTTT Chr9:82826496..82826515 60.29 50
upstream ENSMUSE00000218150 Chr9:82826093..82826193 GGACGGCACTATTTGCTTTT Chr9:82826124..82826143 59.23 45
upstream ENSMUSE00000218149 Chr9:82823911..82823981 GGCCTGGAGTGCAAATGATA Chr9:82823930..82823949 61 50
upstream ENSMUSE00000218144 Chr9:82822582..82822682 ATGTTTTTGGCCACTGGAAG Chr9:82822658..82822677 59.97 45
upstream ENSMUSE00000531477 Chr9:82822436..82822476 No primer for this exon
upstream ENSMUSE00000218152 Chr9:82821707..82821805 GTAGTCGTGATGGGACAGCA Chr9:82821775..82821794 59.71 55
upstream ENSMUSE00000218126 Chr9:82820642..82820795 GGGATCGACATGACAACACA Chr9:82820717..82820736 60.39 50
upstream ENSMUSE00000218164 Chr9:82820004..82820138 GTTCTTGAGCCACACCCATT Chr9:82820098..82820117 59.97 50
upstream ENSMUSE00000531474 Chr9:82808903..82809031 TGATGGTCAGCACTTTGCAT Chr9:82808965..82808984 60.27 45
upstream ENSMUSE00000218136 Chr9:82807295..82807520 CAAGGTACCAGCGATTGGTT Chr9:82807356..82807375 59.99 50
upstream ENSMUSE00000218125 Chr9:82803394..82803531 TTAGTAATGCCAGCCGTGTG Chr9:82803401..82803420 59.75 50
upstream ENSMUSE00000218148 Chr9:82802298..82802481 CGGAGGGTAGTAGTGCCTGA Chr9:82802319..82802338 60.27 60
upstream ENSMUSE00000218155 Chr9:82800548..82800665 GGAGAACTGCAAAGGGAGAA Chr9:82800632..82800651 59.4 50
upstream ENSMUSE00000218162 Chr9:82799256..82799396 AAAAGCAGCAAGCGAATCAG Chr9:82799337..82799356 60.66 45
upstream ENSMUSE00000218153 Chr9:82796731..82796807 GTGGTGGGACTTCTGAGGAA Chr9:82796766..82796785 60.09 55
upstream ENSMUSE00000493659 Chr9:82794229..82794460 TAACTTGCAGCCACCAAAGA Chr9:82794396..82794415 59.46 45
upstream ENSMUSE00000218140 Chr9:82789629..82789748 GAAGAGTGGTTGCCTTCAGC Chr9:82789687..82789706 60 55
upstream ENSMUSE00000218143 Chr9:82787841..82787948 AGCCATGGCATAAGATGGAA Chr9:82787847..82787866 60.44 45
upstream ENSMUSE00000328935 Chr9:82787132..82787256 GACCGGTGGATCATTTACCA Chr9:82787136..82787155 60.58 50
upstream ENSMUSE00000328921 Chr9:82786930..82787012 TGCCTGACGTCATAGATTTTCT Chr9:82786980..82787001 58.86 40.91
upstream ENSMUSE00000328905 Chr9:82783968..82784079 AGATGATGCCTGGTGGTTTG Chr9:82784038..82784057 60.92 50
upstream ENSMUSE00000218147 Chr9:82783721..82783782 GATGAGTCCTTGGGATATGGAA Chr9:82783737..82783758 60.15 45.46
upstream ENSMUSE00000218123 Chr9:82781121..82781276 TCCCAGGGATGAAGAATGTG Chr9:82781160..82781179 60.86 50
upstream ENSMUSE00000218163 Chr9:82780229..82780349 TGGCCTATCCAACGGATCTA Chr9:82780267..82780286 60.43 50
upstream ENSMUSE00000218160 Chr9:82778440..82778565 CATTCAATGAGCCAGGAAGC Chr9:82778493..82778512 60.74 50
upstream ENSMUSE00000218146 Chr9:82775277..82775346 No primer for this exon
upstream ENSMUSE00000218135 Chr9:82774928..82774978 ATGCTGATGTTCCAGGGACT Chr9:82774946..82774965 59.53 50
upstream ENSMUSE00000218142 Chr9:82773719..82773868 AACCTTTTCGACAGCCAGTG Chr9:82773737..82773756 60.29 50
upstream ENSMUSE00000218134 Chr9:82770797..82770949 CTCCAATGGACTTTGCCACT Chr9:82770908..82770927 60.11 50
upstream ENSMUSE00000218124 Chr9:82770333..82770496 AAGAAGCGAAACAGGAGCAG Chr9:82770360..82770379 59.76 50
upstream ENSMUSE00000218127 Chr9:82769616..82769875 CGAACTAGGAGCAACCGTGT Chr9:82769714..82769733 60.31 55
upstream ENSMUSE00000218139 Chr9:82768897..82769094 CAAAGTCAGCCGCAGTCATA Chr9:82768904..82768923 60.01 50

*** Putative Vector Insertion (Chr 9: 82765469 - 82768896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000380837 Chr9:82759766..82765468 TTTCTGCCTCCACGACTCTT Chr9:82765131..82765150 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATTTCATGTGATCCAAACG Chr9:82765907..82765928 59.38 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTCGTGACTGGGAAAAC Chr9:82768830..82768850 61.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032253