Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12257
Trapped Gene
Trip4 (ENSMUSG00000032386)
Vector Insertion
Chr 9: 65699266 - 65700632
Public Clones A051B04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219290 (Chr9:65700633..65700757 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGACCTTCCCCTCAGGAA Chr9:65700676..65700695 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219290 (Chr9:65700633..65700757 -)
Downstram Exon
ENSMUSE00000219293 (Chr9:65699174..65699265 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGACCTTCCCCTCAGGAA Chr9:65700676..65700695 60.04 50 CAACCCGACGGATAGTCATT Chr9:65699210..65699229 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000481020 Chr9:65756246..65756593 CAACGTAGCTGCTTCCATCA Chr9:65756460..65756479 60.01 50
upstream ENSMUSE00000714544 Chr9:65756246..65756483 CAACGTAGCTGCTTCCATCA Chr9:65756460..65756479 60.01 50
upstream ENSMUSE00000502816 Chr9:65746184..65746334 ACACTGGACCCAGGGACATA Chr9:65746315..65746334 60.24 55
upstream ENSMUSE00000711734 Chr9:65746184..65746335 ACACTGGACCCAGGGACATA Chr9:65746315..65746334 60.24 55
upstream ENSMUSE00000501055 Chr9:65744504..65744737 AGGTGCCACTTGGTCCAATA Chr9:65744549..65744568 60.38 50
upstream ENSMUSE00000337707 Chr9:65732735..65732980 AAAACTTTCGCCCTGGATGT Chr9:65732753..65732772 60.86 45
upstream ENSMUSE00000715975 Chr9:65732735..65732863 AAAACTTTCGCCCTGGATGT Chr9:65732753..65732772 60.86 45
upstream ENSMUSE00000716897 Chr9:65732735..65733054 ATCCGAGCACGTTTCTCACT Chr9:65732986..65733005 59.87 50
upstream ENSMUSE00000719031 Chr9:65732735..65732862 AAAACTTTCGCCCTGGATGT Chr9:65732753..65732772 60.86 45
upstream ENSMUSE00000219302 Chr9:65728698..65728867 AGGGCAAAAAGGGTCAATTC Chr9:65728780..65728799 60.3 45
upstream ENSMUSE00000219295 Chr9:65726882..65727015 TGAACCTGACGTAGCTGTGG Chr9:65726911..65726930 59.9 55
upstream ENSMUSE00000219297 Chr9:65722638..65722850 GGCCAGAAGCACAAACTCAT Chr9:65722714..65722733 60.26 50
upstream ENSMUSE00000219298 Chr9:65720906..65720984 ACAGCGGGACTCAAACAAAA Chr9:65720936..65720955 60.67 45
upstream ENSMUSE00000219299 Chr9:65714279..65714408 GGTGGACGTCTCTACCAAGG Chr9:65714370..65714389 59.57 60
upstream ENSMUSE00000219292 Chr9:65712011..65712226 AACCAGTGGCTGTCCAAAGT Chr9:65712152..65712171 59.62 50
upstream ENSMUSE00000219294 Chr9:65706053..65706179 CATGTACCAGGCCTCTCCTC Chr9:65706055..65706074 59.68 60
upstream ENSMUSE00000219300 Chr9:65705131..65705318 GACTTCACTCTCGGCAGGAC Chr9:65705264..65705283 59.99 60
upstream ENSMUSE00000219290 Chr9:65700633..65700757 AAAGACCTTCCCCTCAGGAA Chr9:65700676..65700695 60.04 50

*** Putative Vector Insertion (Chr 9: 65699266 - 65700632) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219293 Chr9:65699174..65699265 CAACCCGACGGATAGTCATT Chr9:65699210..65699229 59.81 50
downstream ENSMUSE00000219296 Chr9:65686742..65686844 ACAACCATTTCCTGGGGATT Chr9:65686752..65686771 60.42 45
downstream ENSMUSE00000707970 Chr9:65680963..65681255 CCCAGCGGATAGCACTTTAG Chr9:65681103..65681122 59.86 55
downstream ENSMUSE00000532554 Chr9:65680032..65681255 GGCTCCAGCAACTGAGATTC Chr9:65680129..65680148 59.96 55
downstream ENSMUSE00000647079 Chr9:65680032..65681255 GGCTCCAGCAACTGAGATTC Chr9:65680129..65680148 59.96 55
downstream ENSMUSE00000709016 Chr9:65679566..65681255 AGTGATCAGCCTCCGAAGAA Chr9:65679839..65679858 59.95 50
downstream ENSMUSE00000708809 Chr9:65678943..65681255 TTCCGAGTAGCTCTGCCATT Chr9:65679316..65679335 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032386