Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12269
Trapped Gene
C230081A13Rik (ENSMUSG00000074305)
Vector Insertion
Chr 9: 56075652 - 56088966
Public Clones A052F08 (ggtc) IST14986F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000352103 (Chr9:56088967..56089151 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTGCAACCTACAGCAAC Chr9:56088971..56088990 59.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000352103 (Chr9:56088967..56089151 -)
Downstram Exon
ENSMUSE00000430897 (Chr9:56074909..56075651 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTGCAACCTACAGCAAC Chr9:56088971..56088990 59.52 55 TAGCCATGACGCAAAGACTG Chr9:56075411..56075430 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698694 Chr9:56265748..56265874 CAATGCTGAATATCGCAACG Chr9:56265765..56265784 60.24 45
upstream ENSMUSE00000698693 Chr9:56222183..56222246 CCCAGGACTTATGCGCTAGA Chr9:56222215..56222234 60.37 55
upstream ENSMUSE00000698692 Chr9:56166470..56166627 GCCAAACTACCTTGCTCACC Chr9:56166500..56166519 59.74 55
upstream ENSMUSE00000384049 Chr9:56105334..56108569 GGTCAAGGAAGCGTTCAGAG Chr9:56107443..56107462 59.99 55
upstream ENSMUSE00000352103 Chr9:56088967..56089151 GCAGTGCAACCTACAGCAAC Chr9:56088971..56088990 59.52 55

*** Putative Vector Insertion (Chr 9: 56075652 - 56088966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000430897 Chr9:56074909..56075651 TAGCCATGACGCAAAGACTG Chr9:56075411..56075430 60.01 50
downstream ENSMUSE00000385855 Chr9:56052936..56055418 CAGGGAAGCAGACGACTAGG Chr9:56055260..56055279 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr9:56076898..56076918 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTTCCCCTTCCGTGACTG Chr9:56085907..56085927 61.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCAGTAGCTCTGCGCTTGAC Chr9:56077159..56077179 59.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCAGTAGCTCTGCGCTTGAC Chr9:56077159..56077179 59.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074305