Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12282
Trapped Gene
AC163298.4 (ENSMUSG00000079490)
Vector Insertion
Chr 16: 98229921 - 98230108
Public Clones A057E07 (ggtc)
Private Clones OST127735 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696811 (Chr16:98229794..98229920 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTGCTGAATCCTTCAC Chr16:98229844..98229863 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696811 (Chr16:98229794..98229920 +)
Downstram Exon
ENSMUSE00000696809 (Chr16:98230109..98230169 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTGCTGAATCCTTCAC Chr16:98229844..98229863 59.82 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696813 Chr16:98218529..98218601 GGTTGGATGCTGTGGATTGT Chr16:98218553..98218572 60.79 50
upstream ENSMUSE00000696811 Chr16:98229794..98229920 GGCTTTGCTGAATCCTTCAC Chr16:98229844..98229863 59.82 50

*** Putative Vector Insertion (Chr 16: 98229921 - 98230108) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696809 Chr16:98230109..98230169 No primer for this exon
downstream ENSMUSE00000696807 Chr16:98236831..98236884 TTCAGCCAGTCCTGGATACC Chr16:98236862..98236881 60.07 55
downstream ENSMUSE00000696806 Chr16:98237007..98237918 CAGACTGTGAAGGGTGAGCA Chr16:98237389..98237408 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr16:98229972..98229992 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000079490