Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12288
Trapped Gene
Hdgfrp2 (ENSMUSG00000002833)
Vector Insertion
Chr 17: 56237409 - 56237906
Public Clones A044F04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297261 (Chr17:56237305..56237408 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297261 (Chr17:56237305..56237408 +)
Downstram Exon
ENSMUSE00000139391 (Chr17:56237907..56237980 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000139379 Chr17:56219080..56219249 No primer for this exon
upstream ENSMUSE00000541812 Chr17:56221523..56221599 No primer for this exon
upstream ENSMUSE00000139388 Chr17:56221700..56221838 No primer for this exon
upstream ENSMUSE00000139369 Chr17:56232945..56233145 No primer for this exon
upstream ENSMUSE00000139381 Chr17:56235440..56235553 No primer for this exon
upstream ENSMUSE00000139367 Chr17:56235628..56235699 No primer for this exon
upstream ENSMUSE00000297347 Chr17:56236271..56236439 No primer for this exon
upstream ENSMUSE00000139390 Chr17:56236511..56236586 No primer for this exon
upstream ENSMUSE00000139387 Chr17:56236658..56236949 No primer for this exon
upstream ENSMUSE00000297261 Chr17:56237305..56237408 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56237409 - 56237906) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139391 Chr17:56237907..56237980 No primer for this exon
downstream ENSMUSE00000139371 Chr17:56238106..56238176 No primer for this exon
downstream ENSMUSE00000139377 Chr17:56238397..56238498 No primer for this exon
downstream ENSMUSE00000139389 Chr17:56238600..56238810 No primer for this exon
downstream ENSMUSE00000139385 Chr17:56239282..56239408 No primer for this exon
downstream ENSMUSE00000139373 Chr17:56239768..56240019 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCAAAAGGAGAAGAGAG Chr17:56237362..56237382 59.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTACCGTGACTGGGAAA Chr17:56237453..56237473 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002833