Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12309
Trapped Gene
Efna4 (ENSMUSG00000028040)
Vector Insertion
Chr 3: 89138773 - 89139098
Public Clones G051E02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000309999 (Chr3:89139099..89139394 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCAGCCCTGTTCGATTCT Chr3:89139174..89139193 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000309999 (Chr3:89139099..89139394 -)
Downstram Exon
ENSMUSE00000175398 (Chr3:89138704..89138772 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCAGCCCTGTTCGATTCT Chr3:89139174..89139193 59.81 45 CTTGCAGCAGACAGACACCT Chr3:89138689..89138708 59.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367369 Chr3:89141760..89141950 GCCACCCAATCTACTGGAAC Chr3:89141774..89141793 59.41 55
upstream ENSMUSE00000309999 Chr3:89139099..89139394 TTTCAGCCCTGTTCGATTCT Chr3:89139174..89139193 59.81 45

*** Putative Vector Insertion (Chr 3: 89138773 - 89139098) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175398 Chr3:89138704..89138772 CTTGCAGCAGACAGACACCT Chr3:89138689..89138708 59.21 55
downstream ENSMUSE00000367062 Chr3:89137660..89138354 CTCAGATCCTCCGACTTTGC Chr3:89138048..89138067 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGTTAATCGCCTTGCAG Chr3:89139033..89139053 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGAGAAGAGTGGGACTTT Chr3:89139054..89139074 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028040