Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12335
Trapped Gene
2810004N23Rik (ENSMUSG00000031984)
Vector Insertion
Chr 8: 127385172 - 127386784
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
D068B10 (ggtc) 5SD117D07 (ggtc) D068B10 (ggtc) D139E02 (ggtc) W171D02 (ggtc)
FHCRC-GT-S6-2H1 (fhcrc) IST14158D10 (tigm) IST14305E1 (tigm) IST14345B4 (tigm)
IST14523G1 (tigm) IST14575E9 (tigm) IST14919C6 (tigm) IST11608F2 (tigm)
IST14907H10 (tigm) IST14590E2 (tigm) IST12214H11 (tigm) IST11556B11 (tigm)
IST14378G6 (tigm)
Private Clones OST444540 (lexicon) OST423532 (lexicon) OST329775 (lexicon) OST269333 (lexicon)
OST250217 (lexicon) OST210964 (lexicon) OST205622 (lexicon) OST194040 (lexicon)
OST148755 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605630 (Chr8:127386785..127386888 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605630 (Chr8:127386785..127386888 -)
Downstram Exon
ENSMUSE00000215451 (Chr8:127384846..127385171 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTAGCTTGCTGCCGTTCTTT Chr8:127384895..127384914 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605630 Chr8:127386785..127386888 No primer for this exon

*** Putative Vector Insertion (Chr 8: 127385172 - 127386784) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215451 Chr8:127384846..127385171 CTAGCTTGCTGCCGTTCTTT Chr8:127384895..127384914 59.79 50
downstream ENSMUSE00000215452 Chr8:127366263..127366319 No primer for this exon
downstream ENSMUSE00000281707 Chr8:127365587..127365682 AAGCGGTGTACTTCCAGACG Chr8:127365638..127365657 60.31 55
downstream ENSMUSE00000281683 Chr8:127365194..127365280 No primer for this exon
downstream ENSMUSE00000215450 Chr8:127364348..127364406 CTGCCCTCTCCCTTTCTTCT Chr8:127364334..127364353 59.95 55
downstream ENSMUSE00000633697 Chr8:127363257..127363866 TGGATAACAAGTGCGCTCAG Chr8:127363326..127363345 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACAGTGAAACGCATCCCTAA Chr8:127386730..127386751 60.12 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACGACCTGGGTGAGCGTAG Chr8:127386773..127386793 61.24 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr8:127386819..127386839 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGAGCGTGACTGGGAAAAC Chr8:127386823..127386843 61.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031984