Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12342
Trapped Gene
Usp9x (ENSMUSG00000031010)
Vector Insertion
Chr X: 12693884 - 12698558
Public Clones W059E04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000205398 (ChrX:12693750..12693883 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCGAAGTCCCCATGTAT ChrX:12693756..12693775 60.48 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000205398 (ChrX:12693750..12693883 +)
Downstram Exon
ENSMUSE00000205401 (ChrX:12698559..12698646 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCGAAGTCCCCATGTAT ChrX:12693756..12693775 60.48 50 AGCCGTTCTTGGACTTCTTG ChrX:12698637..12698656 59.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702979 ChrX:12648624..12648859 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40
upstream ENSMUSE00000707355 ChrX:12648640..12648859 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40
upstream ENSMUSE00000372304 ChrX:12648663..12648848 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40
upstream ENSMUSE00000407874 ChrX:12671042..12671303 TCGAGTATGACAGCCACGAC ChrX:12671202..12671221 59.86 55
upstream ENSMUSE00000702978 ChrX:12671050..12671303 TCGAGTATGACAGCCACGAC ChrX:12671202..12671221 59.86 55
upstream ENSMUSE00000720743 ChrX:12671050..12671303 TCGAGTATGACAGCCACGAC ChrX:12671202..12671221 59.86 55
upstream ENSMUSE00000205428 ChrX:12675576..12675721 AGGAACCTGCATTTCCACAC ChrX:12675667..12675686 59.97 50
upstream ENSMUSE00000205393 ChrX:12677559..12677638 CTCGATGGGTTGTTCCAGTT ChrX:12677561..12677580 59.97 50
upstream ENSMUSE00000205407 ChrX:12680454..12680566 TGAAGCATGTCAGCGATTTT ChrX:12680470..12680489 59.42 40
upstream ENSMUSE00000205423 ChrX:12681709..12681927 CTGCGAGTCAGTGTCCTCAA ChrX:12681849..12681868 60.18 55
upstream ENSMUSE00000205400 ChrX:12684191..12684306 CTCCTCAACAAGTTTGGCACT ChrX:12684206..12684226 59.39 47.62
upstream ENSMUSE00000205394 ChrX:12684790..12685041 GAATTTAGCTTCGCGGGTTC ChrX:12684964..12684983 61.06 50
upstream ENSMUSE00000205395 ChrX:12685116..12685254 CATGGCAGTTCTGAGGATGA ChrX:12685207..12685226 59.79 50
upstream ENSMUSE00000205434 ChrX:12687202..12687354 CGAGATAGCCTTCATCAACCA ChrX:12687241..12687261 60.22 47.62
upstream ENSMUSE00000482455 ChrX:12688218..12688322 AGGGAAACATGAAGCCATTG ChrX:12688220..12688239 59.93 45
upstream ENSMUSE00000205425 ChrX:12690686..12690892 TGAGCTGATTCGTCGTCTTG ChrX:12690730..12690749 60.14 50
upstream ENSMUSE00000205438 ChrX:12691634..12691770 AAATGGGTCATTCCTGCACT ChrX:12691697..12691716 59.41 45
upstream ENSMUSE00000205398 ChrX:12693750..12693883 TCAGCGAAGTCCCCATGTAT ChrX:12693756..12693775 60.48 50

*** Putative Vector Insertion (Chr X: 12693884 - 12698558) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000205401 ChrX:12698559..12698646 AGCCGTTCTTGGACTTCTTG ChrX:12698637..12698656 59.47 50
downstream ENSMUSE00000703046 ChrX:12700294..12700636 AAACAGGCTTCACGATCACA ChrX:12700404..12700423 59.29 45
downstream ENSMUSE00000624777 ChrX:12701694..12701789 ATAGCTCGGCAGGCAATATC ChrX:12701737..12701756 59.31 50
downstream ENSMUSE00000624776 ChrX:12702522..12702733 ACCATTCGAACAGCTTCCTG ChrX:12702652..12702671 60.26 50
downstream ENSMUSE00000624775 ChrX:12705334..12705574 CGGTCATCTCCAGGATCAAT ChrX:12705540..12705559 59.89 50
downstream ENSMUSE00000624774 ChrX:12706103..12706252 CTCCAGGCAAACAACTTTCC ChrX:12706253..12706272 59.71 50
downstream ENSMUSE00000624773 ChrX:12707352..12707472 TGGCGGCATAAGTTTCATAA ChrX:12707474..12707493 59.17 40
downstream ENSMUSE00000624772 ChrX:12708853..12708983 TGGCATGGTCCAAACAAATA ChrX:12708903..12708922 59.79 40
downstream ENSMUSE00000624771 ChrX:12709196..12709474 ACGCCTTCTACACCTGGTTG ChrX:12709461..12709480 60.17 55
downstream ENSMUSE00000624770 ChrX:12712070..12712195 GGGCACTTTGTAGCACCACT ChrX:12712118..12712137 60.18 55
downstream ENSMUSE00000624769 ChrX:12713571..12713696 TCCACATCCTGATGTCCAAA ChrX:12713645..12713664 59.89 45
downstream ENSMUSE00000624768 ChrX:12714734..12714900 TCTTCGAGGTCTGGCTCATT ChrX:12714768..12714787 59.95 50
downstream ENSMUSE00000624767 ChrX:12717235..12717343 TGTGCCACTTGACGAACAGT ChrX:12717258..12717277 60.36 50
downstream ENSMUSE00000624766 ChrX:12717536..12717682 AGTCGCCTGAGTGTTTAGCC ChrX:12717575..12717594 59.5 55
downstream ENSMUSE00000624765 ChrX:12718833..12718979 TTGTAACCCCAAGGTGTCCT ChrX:12718905..12718924 59.3 50
downstream ENSMUSE00000624764 ChrX:12721412..12721634 GATGCGGGAAAGATGAAGTC ChrX:12721446..12721465 59.63 50
downstream ENSMUSE00000624763 ChrX:12722253..12722473 CGTTGTCCTGCTTCTCATCC ChrX:12722474..12722493 60.8 55
downstream ENSMUSE00000624762 ChrX:12725071..12725261 AGCAGCTAAATGGCCAAAGA ChrX:12725217..12725236 59.98 45
downstream ENSMUSE00000624761 ChrX:12728396..12728569 CACGAAGATTGACAGGCTCA ChrX:12728427..12728446 59.98 50
downstream ENSMUSE00000624760 ChrX:12731218..12731359 No primer for this exon
downstream ENSMUSE00000624759 ChrX:12733120..12733873 ACTTCTTTCAATGGCGGATG ChrX:12733761..12733780 60.07 45
downstream ENSMUSE00000624758 ChrX:12734795..12734918 TGGCAGATCCTCGGACTATT ChrX:12734914..12734933 59.65 50
downstream ENSMUSE00000624757 ChrX:12735845..12736070 CTTTGCAAATGCACCTCTCA ChrX:12735992..12736011 59.99 45
downstream ENSMUSE00000624756 ChrX:12736900..12737029 CTCCCTCCGCAAGAGATTTA ChrX:12736968..12736987 59.41 50
downstream ENSMUSE00000624755 ChrX:12737873..12738058 ATTTAATTGGAGGGCCAGGA ChrX:12737968..12737987 60.63 45
downstream ENSMUSE00000624754 ChrX:12738440..12738660 GCAATTTGACGGTCTCATCA ChrX:12738598..12738617 59.65 45
downstream ENSMUSE00000624753 ChrX:12738749..12738837 AAATAGGGCCGGAGTTCATAA ChrX:12738788..12738808 59.82 42.86
downstream ENSMUSE00000624752 ChrX:12741838..12741994 TTGTGTCAAACAGCCCATCT ChrX:12741896..12741915 59.14 45
downstream ENSMUSE00000624751 ChrX:12742398..12742610 CATCTCCAAGCCACTCCACT ChrX:12742455..12742474 60.26 55
downstream ENSMUSE00000624750 ChrX:12743758..12743853 TTGAGATCCAGGGGAATGAG ChrX:12743847..12743866 60 50
downstream ENSMUSE00000501079 ChrX:12746473..12746598 GACACTTCTTCACCGCCTTC ChrX:12746588..12746607 59.85 55
downstream ENSMUSE00000519250 ChrX:12746473..12750454 ACTAGGCTCCAGCCAGCATA ChrX:12747564..12747583 60 55
downstream ENSMUSE00000702977 ChrX:12746601..12750454 ACTAGGCTCCAGCCAGCATA ChrX:12747564..12747583 60 55
downstream ENSMUSE00000702981 ChrX:12766664..12766815 GACACTTCTTCACCGCCTTC ChrX:12766779..12766798 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC ChrX:12693932..12693952 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGTGATTGCCATTCGTGA ChrX:12693920..12693940 60.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031010