Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12350
Trapped Gene
Bcar3 (ENSMUSG00000028121)
Vector Insertion
Chr 3: 122228418 - 122232499
Public Clones A013B04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176416 (Chr3:122228205..122228417 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGCAAGCAATGTGTCAGT Chr3:122228219..122228238 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176416 (Chr3:122228205..122228417 +)
Downstram Exon
ENSMUSE00000332685 (Chr3:122232500..122233098 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGCAAGCAATGTGTCAGT Chr3:122228219..122228238 59.9 50 GGGCTGTTAGGATCTGGTTG Chr3:122232634..122232653 59.55 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333208 Chr3:122122716..122123101 CTTCTCGGGGGAAGATAAGG Chr3:122122732..122122751 60.03 55
upstream ENSMUSE00000263252 Chr3:122129363..122129672 TCCATACGGTCCTGTGACAA Chr3:122129551..122129570 59.96 50
upstream ENSMUSE00000263246 Chr3:122157971..122158010 CTTCTGGACCCAACTCTGGA Chr3:122157981..122158000 60.23 55
upstream ENSMUSE00000563764 Chr3:122207845..122207973 GCTGAGCAGCGAAGACCTAC Chr3:122207916..122207935 60.31 60
upstream ENSMUSE00000176418 Chr3:122211044..122211489 GAAGAACCTCGCTCAGCACT Chr3:122211133..122211152 59.75 55
upstream ENSMUSE00000176433 Chr3:122214137..122214240 AGGAAGGCCTTAACCCTCAA Chr3:122214189..122214208 60.07 50
upstream ENSMUSE00000176429 Chr3:122215269..122215921 ATGATCCTTGATGGGGATGA Chr3:122215661..122215680 60.1 45
upstream ENSMUSE00000176427 Chr3:122222181..122222296 AAGAGGAGCATGGGTGTGAG Chr3:122222214..122222233 60.26 55
upstream ENSMUSE00000176423 Chr3:122226087..122226258 GATGCCATGGGAGACCTCTA Chr3:122226199..122226218 60.03 55
upstream ENSMUSE00000263191 Chr3:122227842..122227953 AGAAAACATGGACGGCTCTG Chr3:122227855..122227874 60.26 50
upstream ENSMUSE00000176416 Chr3:122228205..122228417 CCAGCAAGCAATGTGTCAGT Chr3:122228219..122228238 59.9 50

*** Putative Vector Insertion (Chr 3: 122228418 - 122232499) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332685 Chr3:122232500..122233098 GGGCTGTTAGGATCTGGTTG Chr3:122232634..122232653 59.55 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCCTGGCAGGTAGGGACT Chr3:122231408..122231428 60.48 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCCTGGCAGGTAGGGACT Chr3:122231408..122231428 60.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028121