Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12366
Trapped Gene
Mllt10 (ENSMUSG00000026743)
Vector Insertion
Chr 2: 18125383 - 18127627
Public Clones W084A04 (ggtc) W066E01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700180 (Chr2:18125228..18125382 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGCAGTGGAGTGAAGGA Chr2:18125326..18125345 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700180 (Chr2:18125228..18125382 +)
Downstram Exon
ENSMUSE00000162328 (Chr2:18127628..18127816 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGCAGTGGAGTGAAGGA Chr2:18125326..18125345 59.99 55 ACTGGGGTTTGTCGTTATGG Chr2:18127782..18127801 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700262 Chr2:17976898..17976998 ATAAGCTCTCCCGACGTTCC Chr2:17976904..17976923 60.6 55
upstream ENSMUSE00000700203 Chr2:17986212..17986491 GCCTGCTTGATTATGTGTGC Chr2:17986309..17986328 59.31 50
upstream ENSMUSE00000700156 Chr2:17986263..17986491 GCCTGCTTGATTATGTGTGC Chr2:17986309..17986328 59.31 50
upstream ENSMUSE00000700200 Chr2:17986314..17986491 CAAGGACATGGCTCCTGACT Chr2:17986434..17986453 60.26 55
upstream ENSMUSE00000720056 Chr2:17986662..17986821 GTGTCACTGGAGGACGAGGT Chr2:17986683..17986702 60.16 60
upstream ENSMUSE00000720069 Chr2:17986662..17986821 GTGTCACTGGAGGACGAGGT Chr2:17986683..17986702 60.16 60
upstream ENSMUSE00000424153 Chr2:17992752..17992831 GGACCGTGGTTTTGTAGGAA Chr2:17992781..17992800 59.83 50
upstream ENSMUSE00000700154 Chr2:17992752..17992831 GGACCGTGGTTTTGTAGGAA Chr2:17992781..17992800 59.83 50
upstream ENSMUSE00000700153 Chr2:18014411..18014461 No primer for this exon
upstream ENSMUSE00000700151 Chr2:18022631..18022633 No primer for this exon
upstream ENSMUSE00000162340 Chr2:18023085..18023139 TGTGTCCCCATAAAGATGGA Chr2:18023095..18023114 58.77 45
upstream ENSMUSE00000569864 Chr2:18031409..18031518 ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40
upstream ENSMUSE00000569874 Chr2:18031409..18031518 ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40
upstream ENSMUSE00000162334 Chr2:18043872..18043975 GATGTCGACAGGCTTTCCAT Chr2:18043948..18043967 60.08 50
upstream ENSMUSE00000569863 Chr2:18043872..18043975 GATGTCGACAGGCTTTCCAT Chr2:18043948..18043967 60.08 50
upstream ENSMUSE00000162335 Chr2:18045346..18045439 GGCGCAGACAATGTTCAATA Chr2:18045386..18045405 59.69 45
upstream ENSMUSE00000700197 Chr2:18045346..18045439 GGCGCAGACAATGTTCAATA Chr2:18045386..18045405 59.69 45
upstream ENSMUSE00000162341 Chr2:18047761..18047856 AAAGAGCAAACGGGGATCTAA Chr2:18047763..18047783 60.08 42.86
upstream ENSMUSE00000700194 Chr2:18047761..18047856 AAAGAGCAAACGGGGATCTAA Chr2:18047763..18047783 60.08 42.86
upstream ENSMUSE00000700150 Chr2:18047783..18047856 No primer for this exon
upstream ENSMUSE00000162333 Chr2:18068404..18068499 GAAGCAACCAGAACCGTCAC Chr2:18068442..18068461 60.7 55
upstream ENSMUSE00000700193 Chr2:18068404..18068499 GAAGCAACCAGAACCGTCAC Chr2:18068442..18068461 60.7 55
upstream ENSMUSE00000162330 Chr2:18081083..18081338 TGTCAGCATCTAGCCCCTTT Chr2:18081312..18081331 59.84 50
upstream ENSMUSE00000700192 Chr2:18081083..18081338 TGTCAGCATCTAGCCCCTTT Chr2:18081312..18081331 59.84 50
upstream ENSMUSE00000162332 Chr2:18083944..18084513 AGTGTTGGCTCGTCTCCAGT Chr2:18084486..18084505 59.91 55
upstream ENSMUSE00000700189 Chr2:18083944..18084513 AGTGTTGGCTCGTCTCCAGT Chr2:18084486..18084505 59.91 55
upstream ENSMUSE00000700149 Chr2:18084235..18084513 AGTGTTGGCTCGTCTCCAGT Chr2:18084486..18084505 59.91 55
upstream ENSMUSE00000162337 Chr2:18091881..18091925 TGCAGTATCGACATGATGGAG Chr2:18091890..18091910 59.69 47.62
upstream ENSMUSE00000711455 Chr2:18091881..18091925 TGCAGTATCGACATGATGGAG Chr2:18091890..18091910 59.69 47.62
upstream ENSMUSE00000717167 Chr2:18091881..18091925 TGCAGTATCGACATGATGGAG Chr2:18091890..18091910 59.69 47.62
upstream ENSMUSE00000162325 Chr2:18092670..18092702 No primer for this exon
upstream ENSMUSE00000700187 Chr2:18092670..18092702 No primer for this exon
upstream ENSMUSE00000162336 Chr2:18107845..18108023 CCTTTCCAAACGTGGTGTCT Chr2:18107875..18107894 60.01 50
upstream ENSMUSE00000700185 Chr2:18107845..18108023 CCTTTCCAAACGTGGTGTCT Chr2:18107875..18107894 60.01 50
upstream ENSMUSE00000162327 Chr2:18118210..18118327 TTCTCTCAGTCAGGCACCAG Chr2:18118230..18118249 59.12 55
upstream ENSMUSE00000700184 Chr2:18118210..18118327 TTCTCTCAGTCAGGCACCAG Chr2:18118230..18118249 59.12 55
upstream ENSMUSE00000162329 Chr2:18119552..18119624 No primer for this exon
upstream ENSMUSE00000700183 Chr2:18119552..18119624 No primer for this exon
upstream ENSMUSE00000162338 Chr2:18125228..18125382 AGAGGCAGTGGAGTGAAGGA Chr2:18125326..18125345 59.99 55
upstream ENSMUSE00000700180 Chr2:18125228..18125382 AGAGGCAGTGGAGTGAAGGA Chr2:18125326..18125345 59.99 55

*** Putative Vector Insertion (Chr 2: 18125383 - 18127627) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162328 Chr2:18127628..18127816 ACTGGGGTTTGTCGTTATGG Chr2:18127782..18127801 59.71 50
downstream ENSMUSE00000700174 Chr2:18127628..18127816 ACTGGGGTTTGTCGTTATGG Chr2:18127782..18127801 59.71 50
downstream ENSMUSE00000162339 Chr2:18128178..18128266 GCTGTTCAGGGAATCAGGAG Chr2:18128206..18128225 59.8 55
downstream ENSMUSE00000700172 Chr2:18128178..18128266 GCTGTTCAGGGAATCAGGAG Chr2:18128206..18128225 59.8 55
downstream ENSMUSE00000162342 Chr2:18128407..18128771 CCGTTAATTGCCAGTTGGTT Chr2:18128645..18128664 59.86 45
downstream ENSMUSE00000700164 Chr2:18128407..18128771 CCGTTAATTGCCAGTTGGTT Chr2:18128645..18128664 59.86 45
downstream ENSMUSE00000162326 Chr2:18129410..18129506 CTGCTGCTGCTGGATAAACA Chr2:18129473..18129492 60.16 50
downstream ENSMUSE00000700161 Chr2:18129410..18129506 CTGCTGCTGCTGGATAAACA Chr2:18129473..18129492 60.16 50
downstream ENSMUSE00000162323 Chr2:18130377..18130574 AGCACCTGCAAGGAGATTGT Chr2:18130499..18130518 59.87 50
downstream ENSMUSE00000700160 Chr2:18130377..18130574 AGCACCTGCAAGGAGATTGT Chr2:18130499..18130518 59.87 50
downstream ENSMUSE00000647377 Chr2:18132395..18132597 CTGGCCATTTTCAAGTGTCA Chr2:18132459..18132478 59.69 45
downstream ENSMUSE00000700147 Chr2:18132395..18134013 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700152 Chr2:18132395..18134015 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700202 Chr2:18132395..18134016 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700205 Chr2:18132395..18134017 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026743