Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1237
Trapped Gene
Ythdf3 (ENSMUSG00000047213)
Vector Insertion
Chr 3: 16083521 - 16083921
Public Clones DD0975 (sanger) XB476 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639941 (Chr3:16083250..16083520 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGTTACGGTGAAGAATGT Chr3:16083481..16083500 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639941 (Chr3:16083250..16083520 +)
Downstram Exon
ENSMUSE00000479186 (Chr3:16083922..16083946 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGTTACGGTGAAGAATGT Chr3:16083481..16083500 59.85 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639941 Chr3:16083250..16083520 CGGGTTACGGTGAAGAATGT Chr3:16083481..16083500 59.85 50

*** Putative Vector Insertion (Chr 3: 16083521 - 16083921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000479186 Chr3:16083922..16083946 No primer for this exon
downstream ENSMUSE00000639938 Chr3:16087055..16087115 TCTTCGCCTGTTTCCTCTGT Chr3:16087113..16087132 59.99 50
downstream ENSMUSE00000387713 Chr3:16089478..16089563 No primer for this exon
downstream ENSMUSE00000478291 Chr3:16103187..16103219 ATGAAACAACTGTTTTGCTCTCC Chr3:16103216..16103238 59.69 39.13
downstream ENSMUSE00000676365 Chr3:16103826..16105431 TGAGACTGCACTTGGTGAGG Chr3:16104730..16104749 60.02 55
downstream ENSMUSE00000676367 Chr3:16103826..16105424 TGAGACTGCACTTGGTGAGG Chr3:16104730..16104749 60.02 55
downstream ENSMUSE00000676364 Chr3:16105529..16105542 No primer for this exon
downstream ENSMUSE00000676366 Chr3:16113955..16116852 CACACGGTGGTTATTGCTTG Chr3:16113991..16114010 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:16083571..16083591 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCACGTGACTGGGAAAAC Chr3:16083567..16083587 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047213