Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12386
Trapped Gene
Rps2 (ENSMUSG00000044533)
Vector Insertion
Chr 17: 24857398 - 24857478
Public Clones (sanger) M014F04 (ggtc) IST10361B9 (tigm) IST14177B7 (tigm) IST10398E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000628947 (Chr17:24857055..24857397 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTAGCAAATGGCGGATGAC Chr17:24857213..24857232 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000628947 (Chr17:24857055..24857397 +)
Downstram Exon
ENSMUSE00000138837 (Chr17:24857479..24857676 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTAGCAAATGGCGGATGAC Chr17:24857213..24857232 60.1 50 CTTAATGGGCAGGGAGAACA Chr17:24857571..24857590 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000628947 Chr17:24857055..24857397 ACTAGCAAATGGCGGATGAC Chr17:24857213..24857232 60.1 50

*** Putative Vector Insertion (Chr 17: 24857398 - 24857478) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138837 Chr17:24857479..24857676 CTTAATGGGCAGGGAGAACA Chr17:24857571..24857590 60.07 50
downstream ENSMUSE00000478496 Chr17:24857914..24858247 CAAGACCAACGTGACCATTG Chr17:24857959..24857978 60 50
downstream ENSMUSE00000465206 Chr17:24858568..24858659 CAGAGGTCGGGAGTCAGGTA Chr17:24858628..24858647 60.25 60
downstream ENSMUSE00000497807 Chr17:24858748..24858868 TCTGGTGTGGGTTTTCACAA Chr17:24858786..24858805 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:24857448..24857468 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCGTGGAGGTAAAGCTGAAG Chr17:24857370..24857391 59.13 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044533