Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12387
Trapped Gene
OTTMUSG00000016577 (ENSMUSG00000078869)
Vector Insertion
Chr 2: 177051834 - 177056958
Public Clones M017A07 (ggtc) IST11574A8 (tigm) IST12770C7 (tigm) IST11675F3 (tigm)
IST14674F10 (tigm) IST12304H3 (tigm) IST12570D6 (tigm) IST10353B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678627 (Chr2:177056959..177057028 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGTGTTTTGAGCGCCTCT Chr2:177057005..177057024 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678627 (Chr2:177056959..177057028 -)
Downstram Exon
ENSMUSE00000717291 (Chr2:177051708..177051833 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGTGTTTTGAGCGCCTCT Chr2:177057005..177057024 59.88 45 AGCCCACTCTTCCTGAGTGA Chr2:177051759..177051778 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678627 Chr2:177056959..177057028 AATGTGTTTTGAGCGCCTCT Chr2:177057005..177057024 59.88 45

*** Putative Vector Insertion (Chr 2: 177051834 - 177056958) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678632 Chr2:177051708..177051741 No primer for this exon
downstream ENSMUSE00000717291 Chr2:177051708..177051833 AGCCCACTCTTCCTGAGTGA Chr2:177051759..177051778 59.99 55
downstream ENSMUSE00000678631 Chr2:177051455..177051515 No primer for this exon
downstream ENSMUSE00000709498 Chr2:177049359..177050313 TGGAGATGACTGCTTTGTGC Chr2:177049959..177049978 59.99 50
downstream ENSMUSE00000714365 Chr2:177049359..177050313 TGGAGATGACTGCTTTGTGC Chr2:177049959..177049978 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAAAATTAAGAATTCCATTCC Chr2:177056973..177056996 60.03 34.78 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAAAATTAAGAATTCCATTCC Chr2:177056973..177056996 60.03 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AATTCCTAATCGCCTTGCAG Chr2:177056964..177056984 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAAATTAAGAATTCCCGTGACTG Chr2:177056970..177056994 60.23 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078869