Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12389
Trapped Gene
Eef1a1 (ENSMUSG00000037742)
Vector Insertion
Chr 9: 78328228 - 78328317
Public Clones M025C08 (ggtc) PST7455-NR (escells) PST16629-NR (escells) PST13362-NR (escells)
PST7402-NR (escells) PST12483-NR (escells) PST21269-NR (escells)
Private Clones OST315258 (lexicon) OST234588 (lexicon) OST171013 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389615 (Chr9:78328318..78328495 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCGAACCATCGAAAAGT Chr9:78328338..78328357 60.25 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389615 (Chr9:78328318..78328495 -)
Downstram Exon
ENSMUSE00000531577 (Chr9:78328048..78328227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCGAACCATCGAAAAGT Chr9:78328338..78328357 60.25 45 TTTGCTGGTCTCGAATTTCC Chr9:78328098..78328117 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695236 Chr9:78329446..78329478 No primer for this exon
upstream ENSMUSE00000389615 Chr9:78328318..78328495 CAAGCGAACCATCGAAAAGT Chr9:78328338..78328357 60.25 45

*** Putative Vector Insertion (Chr 9: 78328228 - 78328317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000531577 Chr9:78328048..78328227 TTTGCTGGTCTCGAATTTCC Chr9:78328098..78328117 60.19 45
downstream ENSMUSE00000531576 Chr9:78327659..78327955 TTGTCACCATTCCAACCAGA Chr9:78327659..78327678 59.94 45
downstream ENSMUSE00000531575 Chr9:78327431..78327581 TTGTCAGTTGGACGAGTTGG Chr9:78327450..78327469 59.72 50
downstream ENSMUSE00000531574 Chr9:78327085..78327341 CCAGGCTTGAGAACACCAGT Chr9:78327268..78327287 60.3 55
downstream ENSMUSE00000531573 Chr9:78326765..78326999 TCGCCAGACTTCAGGAACTT Chr9:78326814..78326833 59.99 50
downstream ENSMUSE00000269551 Chr9:78326265..78326665 CCGTTCTTCCACCACTGATT Chr9:78326467..78326486 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTGAGAAGGAGGCTGCTG Chr9:78328318..78328338 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTGAGAAGGAGGCTGCTG Chr9:78328318..78328338 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAAAGCAAAAATGGGAAAGG Chr9:78328450..78328470 59.56 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAAAGGAAAAGCGTGACTG Chr9:78328437..78328457 59.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037742