Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12401
Trapped Gene
2410004B18Rik (ENSMUSG00000036873)
Vector Insertion
Chr 3: 145602061 - 145606760
Public Clones W007F02 (ggtc) W095A01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000226200 (Chr3:145601862..145602060 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGAAGGGGAGGAGACAGT Chr3:145602033..145602052 60.64 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000226200 (Chr3:145601862..145602060 +)
Downstram Exon
ENSMUSE00000356115 (Chr3:145606761..145607238 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGAAGGGGAGGAGACAGT Chr3:145602033..145602052 60.64 60 GGAAAGTCTTGAGGCGACAC Chr3:145606959..145606978 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000226209 Chr3:145601003..145601292 TCCTCTACAACCCGCTCAAC Chr3:145601228..145601247 60.26 55
upstream ENSMUSE00000226200 Chr3:145601862..145602060 CCTGAAGGGGAGGAGACAGT Chr3:145602033..145602052 60.64 60

*** Putative Vector Insertion (Chr 3: 145602061 - 145606760) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000356115 Chr3:145606761..145607238 GGAAAGTCTTGAGGCGACAC Chr3:145606959..145606978 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCTGGTGTTTAAGGCATA Chr3:145602094..145602114 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGAAGGGGAGGAGACAGT Chr3:145602034..145602054 60.64 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036873