Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12411
Trapped Gene
Stmn2 (ENSMUSG00000027500)
Vector Insertion
Chr 3: 8541937 - 8545572
Public Clones W130E04 (ggtc) W142C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311839 (Chr3:8541841..8541936 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCGCAACATCAACATCTAC Chr3:8541907..8541926 60.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311839 (Chr3:8541841..8541936 +)
Downstram Exon
ENSMUSE00000170117 (Chr3:8545573..8545745 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCGCAACATCAACATCTAC Chr3:8541907..8541926 60.29 50 GGTGGCTTCAAGATCAGCTC Chr3:8545642..8545661 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382200 Chr3:8509521..8509630 ACAGCTGGACCCTTCTCCTT Chr3:8509555..8509574 60.25 55
upstream ENSMUSE00000705955 Chr3:8509565..8509630 No primer for this exon
upstream ENSMUSE00000311839 Chr3:8541841..8541936 CGCGCAACATCAACATCTAC Chr3:8541907..8541926 60.29 50

*** Putative Vector Insertion (Chr 3: 8541937 - 8545572) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170117 Chr3:8545573..8545745 GGTGGCTTCAAGATCAGCTC Chr3:8545642..8545661 59.96 55
downstream ENSMUSE00000569583 Chr3:8554792..8554983 TTTCCTGCAGACGTTCAATG Chr3:8554984..8555003 59.84 45
downstream ENSMUSE00000170122 Chr3:8560266..8561604 TAATGCAGCAACCAGCTCAC Chr3:8561280..8561299 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAGTTTAATCGCCTTGC Chr3:8541980..8542000 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAGTTCGTGACTGGGAAA Chr3:8541981..8542001 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027500