Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12427
Trapped Gene
Cox5a (ENSMUSG00000000088)
Vector Insertion
Chr 9: 57369223 - 57376762
Public Clones (sanger) (sanger) (sanger) (sanger) A029F02 (ggtc) IST10132G3 (tigm)
IST10132F3 (tigm) IST14701E2 (tigm)
Private Clones OST458000 (lexicon) OST454398 (lexicon) OST404952 (lexicon) OST404943 (lexicon)
OST375450 (lexicon) OST352207 (lexicon) OST65964 (lexicon) OST63934 (lexicon)
OST62466 (lexicon) OST59362 (lexicon) OST48532 (lexicon) OST34691 (lexicon)
OST32905 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000394700 (Chr9:57369105..57369222 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000394700 (Chr9:57369105..57369222 +)
Downstram Exon
ENSMUSE00000259754 (Chr9:57376763..57376879 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394700 Chr9:57369105..57369222 No primer for this exon

*** Putative Vector Insertion (Chr 9: 57369223 - 57376762) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000259754 Chr9:57376763..57376879 No primer for this exon
downstream ENSMUSE00000218559 Chr9:57378048..57378169 No primer for this exon
downstream ENSMUSE00000259720 Chr9:57379476..57379599 No primer for this exon
downstream ENSMUSE00000378803 Chr9:57380089..57380230 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTATTGCCATCTTTGCT Chr9:57375250..57375270 59.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTATTGCCATCTTTGCT Chr9:57375250..57375270 59.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000088