Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12431
Trapped Gene
Hsp90ab1 (ENSMUSG00000023944)
Vector Insertion
Chr 17: 45708861 - 45710115
Public Clones (sanger) (sanger) 5SE311C10 (ggtc) W099D03 (ggtc) CMHD-GT_423G5-3 (cmhd)
CMHD-GT_487H1-3 (cmhd) IST14800G8 (tigm) IST14710D9 (tigm)
Private Clones OST338471 (lexicon) OST317346 (lexicon) OST289819 (lexicon) OST279219 (lexicon)
OST260687 (lexicon) OST249762 (lexicon) OST204612 (lexicon) OST189632 (lexicon)
OST182528 (lexicon) OST5974 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696089 (Chr17:45710116..45710220 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACCACCCTGCTCTGTACT Chr17:45710138..45710157 60.17 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696089 (Chr17:45710116..45710220 -)
Downstram Exon
ENSMUSE00000136555 (Chr17:45708714..45708860 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACCACCCTGCTCTGTACT Chr17:45710138..45710157 60.17 60 TGAAAGGCAAAGGTCTCCAC Chr17:45708786..45708805 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696089 Chr17:45710116..45710220 CCACCACCCTGCTCTGTACT Chr17:45710138..45710157 60.17 60

*** Putative Vector Insertion (Chr 17: 45708861 - 45710115) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136555 Chr17:45708714..45708860 TGAAAGGCAAAGGTCTCCAC Chr17:45708786..45708805 60.23 50
downstream ENSMUSE00000404358 Chr17:45708362..45708568 TCGTGCCAGACTTAGCAATG Chr17:45708363..45708382 60.01 50
downstream ENSMUSE00000136547 Chr17:45707967..45708126 AGAATCCGACACCAAACTGC Chr17:45708059..45708078 60.12 50
downstream ENSMUSE00000136551 Chr17:45707615..45707748 CTGCGAATGTTTCTTCACCA Chr17:45707620..45707639 59.84 45
downstream ENSMUSE00000136553 Chr17:45707207..45707515 CAAGTGGTCCTCCCAGTCAT Chr17:45707194..45707213 59.96 55
downstream ENSMUSE00000136557 Chr17:45706419..45706775 GATGTTCTTGCGGATGACCT Chr17:45706487..45706506 60.08 50
downstream ENSMUSE00000136550 Chr17:45706189..45706336 GCGTCGGTTAGTGGAATCTT Chr17:45706282..45706301 59.2 50
downstream ENSMUSE00000543014 Chr17:45705807..45706075 TCCCATCAAACTCCTTGAGC Chr17:45705925..45705944 60.19 50
downstream ENSMUSE00000136561 Chr17:45705178..45705511 CAGGGTTGATCTCCAGGTGT Chr17:45705330..45705349 59.96 55
downstream ENSMUSE00000657294 Chr17:45704728..45705073 TTCCAGGAGGCTTTAATCCA Chr17:45704930..45704949 59.64 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTACTCGGCTTTCCCGTCA Chr17:45710116..45710136 62.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTACTCGGCTTTCCCGTCA Chr17:45710116..45710136 62.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGGAGCTCTCTTGAGTCAC Chr17:45710202..45710222 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGGGAGCTCTCTTGAGTCAC Chr17:45710202..45710222 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023944