Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12463
Trapped Gene
Eif2s2 (ENSMUSG00000074656)
Vector Insertion
Chr 2: 154698637 - 154699284
Public Clones F012C06 (ggtc) PST1340-1 (escells) PST5982-NL (escells) PST5982-NR (escells)
Private Clones OST341671 (lexicon) OST68589 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639765 (Chr2:154699285..154699370 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639765 (Chr2:154699285..154699370 -)
Downstram Exon
ENSMUSE00000639763 (Chr2:154698173..154698636 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTAGGATTGTGTCCGGTGA Chr2:154698566..154698585 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681253 Chr2:154718426..154718553 TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50
upstream ENSMUSE00000639772 Chr2:154713919..154714096 AAAAAGACGTGGACGCTGAT Chr2:154713941..154713960 59.74 45
upstream ENSMUSE00000639771 Chr2:154713440..154713543 TTTGACATTGATGAAGCTGAAGA Chr2:154713450..154713472 59.88 34.78
upstream ENSMUSE00000639770 Chr2:154710047..154710182 TGACATTATGCTTGGCAACAA Chr2:154710109..154710129 60.13 38.1
upstream ENSMUSE00000639769 Chr2:154704206..154704300 GGCAGGCTCAGAAAGAGACT Chr2:154704220..154704239 58.77 55
upstream ENSMUSE00000639767 Chr2:154703407..154703555 CAGGTCGTCCGAGTAGGAAC Chr2:154703449..154703468 59.72 60
upstream ENSMUSE00000639766 Chr2:154702352..154702408 CGTCAACCCAAACATCTCCT Chr2:154702382..154702401 59.97 50
upstream ENSMUSE00000639765 Chr2:154699285..154699370 No primer for this exon

*** Putative Vector Insertion (Chr 2: 154698637 - 154699284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639763 Chr2:154698173..154698636 TGTAGGATTGTGTCCGGTGA Chr2:154698566..154698585 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:154699214..154699234 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTAGGCGTGACTGGGAAA Chr2:154699220..154699240 61.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCAATAATCGCCTTGCAG Chr2:154699306..154699326 61.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGGGAAAGCAAGCAAAAAT Chr2:154699398..154699418 59.7 35 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074656