Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12465
Trapped Gene
Atp11b (ENSMUSG00000037400)
Vector Insertion
Chr 3: 35653333 - 35676051
Public Clones F009E08 (ggtc) (ggtc) IST14553H1 (tigm) IST10102F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675883 (Chr3:35653056..35653332 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTCGGAGTCCTCTTCCAC Chr3:35653228..35653247 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675883 (Chr3:35653056..35653332 +)
Downstram Exon
ENSMUSE00000675876 (Chr3:35676052..35676058 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTCGGAGTCCTCTTCCAC Chr3:35653228..35653247 59.83 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675883 Chr3:35653056..35653332 CACTCGGAGTCCTCTTCCAC Chr3:35653228..35653247 59.83 60
upstream ENSMUSE00000675901 Chr3:35653060..35653332 CACTCGGAGTCCTCTTCCAC Chr3:35653228..35653247 59.83 60

*** Putative Vector Insertion (Chr 3: 35653333 - 35676051) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675876 Chr3:35676052..35676058 No primer for this exon
downstream ENSMUSE00000675875 Chr3:35676518..35676528 No primer for this exon
downstream ENSMUSE00000675873 Chr3:35676613..35676618 No primer for this exon
downstream ENSMUSE00000475433 Chr3:35676947..35677063 TTTGATGTGGTGGGTCAAAA Chr3:35676971..35676990 59.79 40
downstream ENSMUSE00000592669 Chr3:35681434..35681523 AGTTTGCCACTCTTCTGAACTG Chr3:35681495..35681516 58.65 45.46
downstream ENSMUSE00000269579 Chr3:35683429..35683509 TCCACTGGTAATTGGACTGG Chr3:35683470..35683489 58.41 50
downstream ENSMUSE00000268964 Chr3:35687009..35687116 CCGAATGTTTTTGGATCGAG Chr3:35687119..35687138 60.44 45
downstream ENSMUSE00000355091 Chr3:35687348..35687476 AGCACCAAATCTGCAGGAAA Chr3:35687406..35687425 60.78 45
downstream ENSMUSE00000362788 Chr3:35688480..35688583 TTCTGGCTGTTGGCATTCTA Chr3:35688572..35688591 59.42 45
downstream ENSMUSE00000474437 Chr3:35694681..35694728 No primer for this exon
downstream ENSMUSE00000510486 Chr3:35697516..35697580 GCTCCACGAAGCAAGAGACT Chr3:35697554..35697573 59.75 55
downstream ENSMUSE00000336029 Chr3:35699406..35699487 No primer for this exon
downstream ENSMUSE00000376642 Chr3:35704656..35704806 TTTTCTTCAGCTTGCCAGGTA Chr3:35704753..35704773 60 42.86
downstream ENSMUSE00000509556 Chr3:35705690..35705887 CTGCCCAAGCTCTTCATTCA Chr3:35705890..35705909 61.46 50
downstream ENSMUSE00000517766 Chr3:35708279..35708518 GTGAGATGGGCTGAGTTGCT Chr3:35708478..35708497 60.42 55
downstream ENSMUSE00000410556 Chr3:35709043..35709218 TGCCGTCAGTTTGAACATTG Chr3:35709124..35709143 60.7 45
downstream ENSMUSE00000513225 Chr3:35709568..35709636 No primer for this exon
downstream ENSMUSE00000449110 Chr3:35710985..35711058 GGTGCCTGAACAATTACACTCA Chr3:35711054..35711075 60.04 45.46
downstream ENSMUSE00000268849 Chr3:35711135..35711238 No primer for this exon
downstream ENSMUSE00000568919 Chr3:35712966..35713147 No primer for this exon
downstream ENSMUSE00000568918 Chr3:35718831..35719034 TACCAGCCATTCTCAGTGCTT Chr3:35718882..35718902 59.89 47.62
downstream ENSMUSE00000268831 Chr3:35725867..35726020 CATGTTCCCTGAGTGCAAGA Chr3:35725946..35725965 59.83 50
downstream ENSMUSE00000378105 Chr3:35727523..35727625 ATGCGCTTCTTGTATCATGC Chr3:35727618..35727637 58.9 45
downstream ENSMUSE00000675881 Chr3:35728339..35728610 TGCTGAACCACTGCCAATAG Chr3:35728391..35728410 59.86 50
downstream ENSMUSE00000386025 Chr3:35730288..35730433 TTGCAGCTTGTCTTCCCTCT Chr3:35730323..35730342 60.13 50
downstream ENSMUSE00000352782 Chr3:35731843..35731902 AAACTGGGGTGTGATAAAGCA Chr3:35731871..35731891 59.49 42.86
downstream ENSMUSE00000345645 Chr3:35733217..35733344 CGATAGAGGGTAGGCTTGCTC Chr3:35733346..35733366 60.37 57.14
downstream ENSMUSE00000449080 Chr3:35734161..35734299 CCAGGACGGTCCAGTAAAGA Chr3:35734222..35734241 60.1 55
downstream ENSMUSE00000449075 Chr3:35735881..35735946 No primer for this exon
downstream ENSMUSE00000357845 Chr3:35736408..35736511 TGGTTGATCCAAGTCCAGAA Chr3:35736448..35736467 59.06 45
downstream ENSMUSE00000395883 Chr3:35737971..35738136 CAAACCAAGCTGACCCACTT Chr3:35738044..35738063 60.15 50
downstream ENSMUSE00000172464 Chr3:35748356..35748486 GACTCGCTCCAGCATTCTTC Chr3:35748457..35748476 60.1 55
downstream ENSMUSE00000639538 Chr3:35754027..35755193 GGAGAGATGCGGTGGATTTA Chr3:35754959..35754978 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCTTGCTCAAACTTCAGG Chr3:35653347..35653367 58.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTTGCTCAAACTTCAGG Chr3:35653347..35653367 58.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037400