Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12483
Trapped Gene
Mbtd1 (ENSMUSG00000059474)
Vector Insertion
Chr 11: 93795194 - 93795273
Public Clones W095D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648813 (Chr11:93795195..93795272 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAGCCAATCAGCTTCTTCA Chr11:93795203..93795223 59.58 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648813 (Chr11:93795195..93795272 +)
Downstram Exon
ENSMUSE00000648819 (Chr11:93795195..93795272 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAGCCAATCAGCTTCTTCA Chr11:93795203..93795223 59.58 42.86 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674600 Chr11:93747166..93747376 CGGAGGCAACATATTGGAAG Chr11:93747240..93747259 60.46 50
upstream ENSMUSE00000674593 Chr11:93747180..93747435 TCATCGACTTGTGGTCTTGG Chr11:93747358..93747377 59.68 50
upstream ENSMUSE00000481276 Chr11:93747531..93747730 GCCCTGATGGAAAACACAAA Chr11:93747704..93747723 60.87 45
upstream ENSMUSE00000509812 Chr11:93747533..93747730 GCCCTGATGGAAAACACAAA Chr11:93747704..93747723 60.87 45
upstream ENSMUSE00000674596 Chr11:93748194..93748387 CACCATCCGTACGTTCTCCT Chr11:93748288..93748307 59.99 55
upstream ENSMUSE00000478298 Chr11:93748336..93748387 No primer for this exon
upstream ENSMUSE00000501673 Chr11:93752653..93752702 CCTCCACTCAGAGATGTGATGA Chr11:93752665..93752686 60.26 50
upstream ENSMUSE00000674598 Chr11:93766467..93766672 AGACTGGTTCGGGATGTTTG Chr11:93766506..93766525 59.97 50
upstream ENSMUSE00000621827 Chr11:93766473..93766672 AGACTGGTTCGGGATGTTTG Chr11:93766506..93766525 59.97 50
upstream ENSMUSE00000648836 Chr11:93766473..93766672 AGACTGGTTCGGGATGTTTG Chr11:93766506..93766525 59.97 50
upstream ENSMUSE00000713589 Chr11:93766473..93766672 AGACTGGTTCGGGATGTTTG Chr11:93766506..93766525 59.97 50
upstream ENSMUSE00000648833 Chr11:93770118..93770251 TGTGAGATGTGTGGGATGGT Chr11:93770123..93770142 59.8 50
upstream ENSMUSE00000648831 Chr11:93771597..93771720 GCCTATGCCCAGTATCAAGC Chr11:93771660..93771679 59.7 55
upstream ENSMUSE00000648827 Chr11:93773690..93773772 AGGCTTCAGCTGGGGTAACT Chr11:93773703..93773722 60.27 55
upstream ENSMUSE00000648826 Chr11:93782681..93782798 CTGGGGTGATATCTCGGAAA Chr11:93782698..93782717 59.89 50
upstream ENSMUSE00000674591 Chr11:93782681..93782789 CTGGGGTGATATCTCGGAAA Chr11:93782698..93782717 59.89 50
upstream ENSMUSE00000110602 Chr11:93784460..93784594 TTGGTGTGCAGCTAGTGGAA Chr11:93784554..93784573 60.45 50
upstream ENSMUSE00000110594 Chr11:93785105..93785193 ACTGGTGCCAAAACACTTCC Chr11:93785155..93785174 60.01 50
upstream ENSMUSE00000421092 Chr11:93785739..93785973 ACATGCACAGCCCCTTAATC Chr11:93785905..93785924 59.96 50
upstream ENSMUSE00000311768 Chr11:93786981..93787036 CGAAGAAACAGGACGGACAT Chr11:93786987..93787006 60.11 50
upstream ENSMUSE00000521440 Chr11:93787536..93787640 CCAGAGTGGAGAATGGTTCAA Chr11:93787550..93787570 60.1 47.62
upstream ENSMUSE00000494296 Chr11:93790928..93791075 CTGGCTGATGGATTCCTGAT Chr11:93790931..93790950 60.03 50
upstream ENSMUSE00000648811 Chr11:93790928..93791592 CTGGCTGATGGATTCCTGAT Chr11:93790931..93790950 60.03 50
upstream ENSMUSE00000648816 Chr11:93793127..93793209 CTCCATTGCAGCACCAGTAA Chr11:93793176..93793195 59.86 50
upstream ENSMUSE00000648823 Chr11:93793127..93793209 CTCCATTGCAGCACCAGTAA Chr11:93793176..93793195 59.86 50
upstream ENSMUSE00000648815 Chr11:93793534..93793768 CTCATGGAGCCACGGTTAAT Chr11:93793585..93793604 59.96 50
upstream ENSMUSE00000648821 Chr11:93793534..93793768 CTCATGGAGCCACGGTTAAT Chr11:93793585..93793604 59.96 50
upstream ENSMUSE00000674597 Chr11:93793534..93794095 CTCATGGAGCCACGGTTAAT Chr11:93793585..93793604 59.96 50

*** Putative Vector Insertion (Chr 11: 93795194 - 93795273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648813 Chr11:93795195..93795272 No primer for this exon
downstream ENSMUSE00000648819 Chr11:93795195..93795272 No primer for this exon
downstream ENSMUSE00000511364 Chr11:93804976..93806615 CAATAAAACGTCAGCGAGCA Chr11:93805748..93805767 60.01 45
downstream ENSMUSE00000519418 Chr11:93805089..93806615 CAATAAAACGTCAGCGAGCA Chr11:93805748..93805767 60.01 45
downstream ENSMUSE00000674599 Chr11:93805089..93808299 CAATAAAACGTCAGCGAGCA Chr11:93805748..93805767 60.01 45
downstream ENSMUSE00000674601 Chr11:93805089..93806615 CAATAAAACGTCAGCGAGCA Chr11:93805748..93805767 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATCAAGAGAAAGCCAATCA Chr11:93795195..93795216 60.35 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATCAAGAGAAAGCCAATCA Chr11:93795195..93795216 60.35 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059474