Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12490
Trapped Gene
Cstf2 (ENSMUSG00000031256)
Vector Insertion
Chr X: 130593962 - 130595182
Public Clones A025F02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695034 (ChrX:130593754..130593961 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695034 (ChrX:130593754..130593961 +)
Downstram Exon
ENSMUSE00000695030 (ChrX:130595183..130595261 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCCCAACCTCAGAGAAAATG ChrX:130595248..130595267 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695039 ChrX:130593726..130593961 No primer for this exon
upstream ENSMUSE00000695034 ChrX:130593754..130593961 No primer for this exon
upstream ENSMUSE00000695065 ChrX:130593873..130593961 No primer for this exon
upstream ENSMUSE00000707981 ChrX:130593888..130593961 No primer for this exon
upstream ENSMUSE00000713812 ChrX:130593888..130593961 No primer for this exon

*** Putative Vector Insertion (Chr X: 130593962 - 130595182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207638 ChrX:130595183..130595261 GCCCAACCTCAGAGAAAATG ChrX:130595248..130595267 59.67 50
downstream ENSMUSE00000695030 ChrX:130595183..130595261 GCCCAACCTCAGAGAAAATG ChrX:130595248..130595267 59.67 50
downstream ENSMUSE00000207637 ChrX:130595484..130595653 GAATTCACGCCCATTCAAGT ChrX:130595595..130595614 59.94 45
downstream ENSMUSE00000695029 ChrX:130595484..130595653 GAATTCACGCCCATTCAAGT ChrX:130595595..130595614 59.94 45
downstream ENSMUSE00000207648 ChrX:130596233..130596369 GGGCTGATGCTTTCTCCATA ChrX:130596290..130596309 60.18 50
downstream ENSMUSE00000709193 ChrX:130596233..130596369 GGGCTGATGCTTTCTCCATA ChrX:130596290..130596309 60.18 50
downstream ENSMUSE00000709881 ChrX:130596233..130596369 GGGCTGATGCTTTCTCCATA ChrX:130596290..130596309 60.18 50
downstream ENSMUSE00000207646 ChrX:130596907..130597026 CCTGGGGACTATTCTGGACA ChrX:130596934..130596953 59.92 55
downstream ENSMUSE00000695018 ChrX:130596907..130597026 CCTGGGGACTATTCTGGACA ChrX:130596934..130596953 59.92 55
downstream ENSMUSE00000695017 ChrX:130597137..130597274 GGATATTTGTCTGGCGATGC ChrX:130597167..130597186 60.44 50
downstream ENSMUSE00000711029 ChrX:130597137..130597274 GGATATTTGTCTGGCGATGC ChrX:130597167..130597186 60.44 50
downstream ENSMUSE00000711642 ChrX:130597137..130597274 GGATATTTGTCTGGCGATGC ChrX:130597167..130597186 60.44 50
downstream ENSMUSE00000207649 ChrX:130600800..130600923 GGAACTCCACCTGGCATAGA ChrX:130600864..130600883 60.07 55
downstream ENSMUSE00000695061 ChrX:130600800..130600923 GGAACTCCACCTGGCATAGA ChrX:130600864..130600883 60.07 55
downstream ENSMUSE00000207640 ChrX:130604384..130604446 CAGCTCCTTGCATTCCAACT ChrX:130604422..130604441 60.4 50
downstream ENSMUSE00000695059 ChrX:130604384..130604446 CAGCTCCTTGCATTCCAACT ChrX:130604422..130604441 60.4 50
downstream ENSMUSE00000695024 ChrX:130606954..130607013 No primer for this exon
downstream ENSMUSE00000695023 ChrX:130607217..130607303 GGAGTAGAGCCTCGGACAGA ChrX:130607265..130607284 59.56 60
downstream ENSMUSE00000207641 ChrX:130607675..130607816 GAGGAGTTGGGACGTTGGTA ChrX:130607743..130607762 59.97 55
downstream ENSMUSE00000695057 ChrX:130607675..130607816 GAGGAGTTGGGACGTTGGTA ChrX:130607743..130607762 59.97 55
downstream ENSMUSE00000695037 ChrX:130607753..130607816 No primer for this exon
downstream ENSMUSE00000695055 ChrX:130608665..130608849 CCATTAAAGGTCTCGGCTCA ChrX:130608798..130608817 60.21 50
downstream ENSMUSE00000712268 ChrX:130608665..130608849 CCATTAAAGGTCTCGGCTCA ChrX:130608798..130608817 60.21 50
downstream ENSMUSE00000712531 ChrX:130608665..130608849 CCATTAAAGGTCTCGGCTCA ChrX:130608798..130608817 60.21 50
downstream ENSMUSE00000207647 ChrX:130609052..130609344 ATTGGATTGGGACCTTGGAT ChrX:130609310..130609329 60.39 45
downstream ENSMUSE00000695033 ChrX:130609052..130610402 CTGGAGCAAACCAACTGACA ChrX:130609949..130609968 59.87 50
downstream ENSMUSE00000695053 ChrX:130609052..130609344 ATTGGATTGGGACCTTGGAT ChrX:130609310..130609329 60.39 45
downstream ENSMUSE00000207644 ChrX:130614866..130614976 GTCCAGGACTAAAGCCACCA ChrX:130614947..130614966 60.11 55
downstream ENSMUSE00000695052 ChrX:130614866..130614976 GTCCAGGACTAAAGCCACCA ChrX:130614947..130614966 60.11 55
downstream ENSMUSE00000207643 ChrX:130615730..130615855 TGAGCTGAAGGACCTGCATA ChrX:130615763..130615782 59.55 50
downstream ENSMUSE00000695051 ChrX:130615730..130615855 TGAGCTGAAGGACCTGCATA ChrX:130615763..130615782 59.55 50
downstream ENSMUSE00000349146 ChrX:130618771..130621360 ACAATAAGCACGCTGGCTCT ChrX:130620877..130620896 60.04 50
downstream ENSMUSE00000695036 ChrX:130618771..130620585 TTCCTCCCAGAAAGCTCTGA ChrX:130619274..130619293 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCTTCGGTGAGAGGATTT ChrX:130593955..130593975 59.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTCTTCGGTGAGAGGATTT ChrX:130593955..130593975 59.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031256