Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12501
Trapped Gene
1810055G02Rik (ENSMUSG00000035372)
Vector Insertion
Chr 19: 3708437 - 3714403
Public Clones (sanger) (sanger) D185A02 (ggtc) W172B01 (ggtc) D185A02 (ggtc)
IST14464E7 (tigm) IST10115A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000239177 (Chr19:3708333..3708436 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAGCTAACTGGGTTTCG Chr19:3708335..3708354 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000239177 (Chr19:3708333..3708436 +)
Downstram Exon
ENSMUSE00000239150 (Chr19:3714404..3714625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAGCTAACTGGGTTTCG Chr19:3708335..3708354 60.01 55 CAGATGCCCCTCTGTGGTAT Chr19:3714459..3714478 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000239177 Chr19:3708333..3708436 GCTGAGCTAACTGGGTTTCG Chr19:3708335..3708354 60.01 55

*** Putative Vector Insertion (Chr 19: 3708437 - 3714403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239150 Chr19:3714404..3714625 CAGATGCCCCTCTGTGGTAT Chr19:3714459..3714478 59.95 55
downstream ENSMUSE00000239124 Chr19:3715638..3715802 CACAGAGGAAATCCACACCA Chr19:3715768..3715787 59.52 50
downstream ENSMUSE00000239096 Chr19:3716491..3717881 TGTTCCGTGTGTTGTCACCT Chr19:3716687..3716706 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATATGCAGGTGGGCTTGTG Chr19:3708414..3708434 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATATGCAGGTGGGCTTGTG Chr19:3708414..3708434 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035372