Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12523
Trapped Gene
AC102176.8-201 (ENSMUSG00000063480)
Vector Insertion
Chr 15: 81872799 - 81874326
Public Clones W079E08 (ggtc)
Private Clones OST460963 (lexicon) OST457575 (lexicon) OST391464 (lexicon) OST378744 (lexicon)
OST375797 (lexicon) OST327544 (lexicon) OST210062 (lexicon) OST23928 (lexicon)
OST9480 (lexicon) OST1430 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556697 (Chr15:81874327..81874447 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCTGATGTGAATCCGAAG Chr15:81874424..81874443 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556697 (Chr15:81874327..81874447 -)
Downstram Exon
ENSMUSE00000509796 (Chr15:81871770..81872798 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCTGATGTGAATCCGAAG Chr15:81874424..81874443 60.22 50 CTTGTCTTCGCACAGCAGAG Chr15:81872673..81872692 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680671 Chr15:81877917..81877975 TCTTGAGTTGGGCTGTCGTC Chr15:81877950..81877969 61.4 55
upstream ENSMUSE00000556697 Chr15:81874327..81874447 AGGCTGATGTGAATCCGAAG Chr15:81874424..81874443 60.22 50

*** Putative Vector Insertion (Chr 15: 81872799 - 81874326) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000509796 Chr15:81871770..81872798 CTTGTCTTCGCACAGCAGAG Chr15:81872673..81872692 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGAAGGTTCGTTTTCAG Chr15:81874277..81874297 59.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGAAGGTTCGTTTTCAG Chr15:81874277..81874297 59.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063480