Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12540
Trapped Gene
Kank2 (ENSMUSG00000032194)
Vector Insertion
Chr 9: 21585148 - 21598900
Public Clones W073F04 (ggtc) (ggtc) IST14783C9 (tigm) IST12734F12 (tigm) IST14790F7 (tigm)
IST13824H6 (tigm) IST12902E7 (tigm) IST11388D7 (tigm) IST11190A6 (tigm)
Private Clones OST369510 (lexicon) OST351509 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393980 (Chr9:21598901..21600127 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTGGAACCCTACGGAACA Chr9:21599073..21599092 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393980 (Chr9:21598901..21600127 -)
Downstram Exon
ENSMUSE00000217598 (Chr9:21585004..21585147 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTGGAACCCTACGGAACA Chr9:21599073..21599092 59.97 55 CAGGGTTCTCAGGCTGTACC Chr9:21585066..21585085 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389762 Chr9:21602926..21602979 No primer for this exon
upstream ENSMUSE00000702625 Chr9:21600524..21600638 GCTGTTGGGGAGACTCAGTT Chr9:21600598..21600617 59.31 55
upstream ENSMUSE00000393980 Chr9:21598901..21600127 GTCTGGAACCCTACGGAACA Chr9:21599073..21599092 59.97 55

*** Putative Vector Insertion (Chr 9: 21585148 - 21598900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217598 Chr9:21585004..21585147 CAGGGTTCTCAGGCTGTACC Chr9:21585066..21585085 59.72 60
downstream ENSMUSE00000217595 Chr9:21584823..21584913 TGGAGGTTCCTCTGGTTGAC Chr9:21584822..21584841 60.09 55
downstream ENSMUSE00000217601 Chr9:21584145..21584381 TCTCTGTGCTCTCGTGTTCG Chr9:21584298..21584317 60.33 55
downstream ENSMUSE00000217592 Chr9:21580145..21580232 GGTATTTCTCCAGGGCCAAG Chr9:21580158..21580177 60.82 55
downstream ENSMUSE00000411828 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000702616 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000376094 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000702615 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000337246 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000702614 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000356457 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000702613 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000394948 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55
downstream ENSMUSE00000584853 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:21592830..21592850 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACCAAGCCATAACACACA Chr9:21592849..21592869 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr9:21594058..21594078 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGACGTGACTGGGAAAAC Chr9:21594062..21594082 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032194