Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12551
Trapped Gene
1810029B16Rik (ENSMUSG00000025591)
Vector Insertion
Chr 8: 69008070 - 69010310
Public Clones W069B03 (ggtc)
Private Clones OST210060 (lexicon) OST181675 (lexicon) OST128039 (lexicon) OST39826 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151988 (Chr8:69010311..69010406 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGAAGCGGACTTGAGAGC Chr8:69010382..69010401 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151988 (Chr8:69010311..69010406 -)
Downstram Exon
ENSMUSE00000151987 (Chr8:69007957..69008069 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGAAGCGGACTTGAGAGC Chr8:69010382..69010401 59.31 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000151988 Chr8:69010311..69010406 GAAGAAGCGGACTTGAGAGC Chr8:69010382..69010401 59.31 55

*** Putative Vector Insertion (Chr 8: 69008070 - 69010310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151987 Chr8:69007957..69008069 No primer for this exon
downstream ENSMUSE00000151985 Chr8:69006405..69006442 CAATAAGGTTGAGACGCAAGG Chr8:69006383..69006403 59.76 47.62
downstream ENSMUSE00000151991 Chr8:69005362..69005446 No primer for this exon
downstream ENSMUSE00000151989 Chr8:69004239..69004387 ACTGCTGAACCGATCCAAGT Chr8:69004344..69004363 59.73 50
downstream ENSMUSE00000151986 Chr8:69001914..69001956 No primer for this exon
downstream ENSMUSE00000636652 Chr8:69000245..69000808 GCGCTTCTTAGGAACTGCAT Chr8:69000705..69000724 59.62 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:69010240..69010260 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGACGTGACTGGGAAAAC Chr8:69010244..69010264 63.92 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025591