Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12564
Trapped Gene
Zfp207 (ENSMUSG00000017421)
Vector Insertion
Chr 11: 80196832 - 80196998
Public Clones M041F03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513672 (Chr11:80196832..80196997 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513672 (Chr11:80196832..80196997 +)
Downstram Exon
ENSMUSE00000649789 (Chr11:80196833..80196997 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513672 Chr11:80196832..80196997 No primer for this exon

*** Putative Vector Insertion (Chr 11: 80196832 - 80196998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000649789 Chr11:80196833..80196997 No primer for this exon
downstream ENSMUSE00000108276 Chr11:80199405..80199531 No primer for this exon
downstream ENSMUSE00000108283 Chr11:80201304..80201442 No primer for this exon
downstream ENSMUSE00000108284 Chr11:80202480..80202647 No primer for this exon
downstream ENSMUSE00000108277 Chr11:80202757..80202832 No primer for this exon
downstream ENSMUSE00000108279 Chr11:80203276..80203323 No primer for this exon
downstream ENSMUSE00000108286 Chr11:80204833..80204903 No primer for this exon
downstream ENSMUSE00000108281 Chr11:80205337..80205494 No primer for this exon
downstream ENSMUSE00000108274 Chr11:80206586..80206678 No primer for this exon
downstream ENSMUSE00000675959 Chr11:80206586..80207785 No primer for this exon
downstream ENSMUSE00000282721 Chr11:80207788..80208033 No primer for this exon
downstream ENSMUSE00000282716 Chr11:80208604..80208763 No primer for this exon
downstream ENSMUSE00000675963 Chr11:80208892..80209637 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCCATTTTGTGTCTGTTT Chr11:80196818..80196838 60.92 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACTCTGCGAGCGTGACT Chr11:80196870..80196890 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017421