Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12607
Trapped Gene
C920016K16Rik (ENSMUSG00000053390)
Vector Insertion
Chr 17: 33138696 - 33138902
Public Clones F036E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000547089 (Chr17:33138569..33138695 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTGTGAACTTCAGCCTA Chr17:33138591..33138610 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000547089 (Chr17:33138569..33138695 +)
Downstram Exon
ENSMUSE00000657704 (Chr17:33138903..33138958 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTGTGAACTTCAGCCTA Chr17:33138591..33138610 59.59 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699328 Chr17:33130183..33130203 No primer for this exon
upstream ENSMUSE00000657706 Chr17:33137801..33137821 No primer for this exon
upstream ENSMUSE00000547089 Chr17:33138569..33138695 TGGCTGTGAACTTCAGCCTA Chr17:33138591..33138610 59.59 50

*** Putative Vector Insertion (Chr 17: 33138696 - 33138902) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378171 Chr17:33138903..33138963 No primer for this exon
downstream ENSMUSE00000657704 Chr17:33138903..33138958 No primer for this exon
downstream ENSMUSE00000467730 Chr17:33139480..33139577 GGCACGACTGATTTTGCTTC Chr17:33139540..33139559 60.79 50
downstream ENSMUSE00000699320 Chr17:33139695..33141000 AGGAGGCGTGTCTCTACGAA Chr17:33139808..33139827 60.01 55
downstream ENSMUSE00000699325 Chr17:33139703..33142402 AGGAGGCGTGTCTCTACGAA Chr17:33139808..33139827 60.01 55
downstream ENSMUSE00000699318 Chr17:33141444..33141457 No primer for this exon
downstream ENSMUSE00000699316 Chr17:33145209..33145254 TAACTGCAGCACCTGAATGC Chr17:33145240..33145259 60.02 50
downstream ENSMUSE00000699315 Chr17:33146484..33146518 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:33138747..33138767 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAACGTGACTGGGAAAACC Chr17:33138742..33138763 60.91 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053390