Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12653
Trapped Gene
Gpx1 (ENSMUSG00000063856)
Vector Insertion
Chr 9: 108241890 - 108242107
Public Clones W121E01 (ggtc) 5SE288H09 (ggtc) CMHD-GT_366B3-3 (cmhd) CMHD-GT_544C5-3 (cmhd)
CMHD-GT_386C9-3 (cmhd) CMHD-GT_444A10-3 (cmhd) CMHD-GT_385E6-3 (cmhd) CMHD-GT_434E3-3 (cmhd)
FHCRC-GT-S21-6G1 (fhcrc) IST14859A4 (tigm)
Private Clones OST433074 (lexicon) OST432065 (lexicon) OST413852 (lexicon) OST341403 (lexicon)
OST172421 (lexicon) OST167626 (lexicon) OST143017 (lexicon) OST129953 (lexicon)
OST43293 (lexicon) OST28499 (lexicon) OST17521 (lexicon) OST16450 (lexicon)
OST14326 (lexicon) OST1373 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660034 (Chr9:108241605..108241889 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCCACCGTGTATGCCTTC Chr9:108241675..108241694 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660034 (Chr9:108241605..108241889 +)
Downstram Exon
ENSMUSE00000660036 (Chr9:108242108..108242669 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCCACCGTGTATGCCTTC Chr9:108241675..108241694 60 55 TTCGATGTCGATGGTACGAA Chr9:108242425..108242444 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660034 Chr9:108241605..108241889 AGTCCACCGTGTATGCCTTC Chr9:108241675..108241694 60 55

*** Putative Vector Insertion (Chr 9: 108241890 - 108242107) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000660036 Chr9:108242108..108242669 TTCGATGTCGATGGTACGAA Chr9:108242425..108242444 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTCCCGTGCAATCAGTTC Chr9:108241862..108241882 60.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCCCGTGCAATCAGTTC Chr9:108241862..108241882 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063856