Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1266
Trapped Gene
Tex264 (ENSMUSG00000040813)
Vector Insertion
Chr 9: 106561639 - 106564690
Public Clones DD0558 (sanger) CSI548 (baygenomics) CSH410 (baygenomics) PST2093-NR (escells)
PST10128-NR (escells)
Private Clones OST183197 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260039 (Chr9:106564691..106564859 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTACGTGCCAGAGGTGAA Chr9:106564753..106564772 59.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260039 (Chr9:106564691..106564859 -)
Downstram Exon
ENSMUSE00000634505 (Chr9:106561084..106561638 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTACGTGCCAGAGGTGAA Chr9:106564753..106564772 59.44 50 GGAAGGAGGTTTAGGCTTGG Chr9:106561195..106561214 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371901 Chr9:106588166..106588246 CACGACTGAGCCCCTATCTT Chr9:106588205..106588224 59.31 55
upstream ENSMUSE00000385038 Chr9:106587260..106587326 CCTGCTGGACTGGATGCTAT Chr9:106587290..106587309 60.24 55
upstream ENSMUSE00000260073 Chr9:106584199..106584494 CCATGCCGGATCTCCTACTA Chr9:106584439..106584458 60.05 55
upstream ENSMUSE00000260052 Chr9:106575848..106576069 AGTCCATCCTGCCTTGGATA Chr9:106575859..106575878 59.51 50
upstream ENSMUSE00000260039 Chr9:106564691..106564859 TTCTACGTGCCAGAGGTGAA Chr9:106564753..106564772 59.44 50

*** Putative Vector Insertion (Chr 9: 106561639 - 106564690) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634505 Chr9:106561084..106561638 GGAAGGAGGTTTAGGCTTGG Chr9:106561195..106561214 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr9:106561620..106561640 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTACCAAAGGTGGAGGA Chr9:106561672..106561692 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CACACTCCCTTGGCTCTCTC Chr9:106561833..106561853 59.99 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTAGGAGCGGAAGCTGTGTG Chr9:106561842..106561862 61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040813