Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1267
Trapped Gene
Rbm16 (ENSMUSG00000046201)
Vector Insertion
Chr 17: 3115419 - 3145074
Public Clones (sanger) DD0553 (sanger) (sanger) DD0552 (sanger) XB591 (baygenomics)
XA153 (baygenomics) D070G02 (ggtc) PST20604-NR (escells) IST11978G10 (tigm)
IST14001F11 (tigm) IST14971H10 (tigm) IST14430G2 (tigm)
Private Clones OST310224 (lexicon) OST297623 (lexicon) OST139040 (lexicon) OST36951 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658492 (Chr17:3114967..3115418 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658492 (Chr17:3114967..3115418 +)
Downstram Exon
ENSMUSE00000367004 (Chr17:3145075..3145158 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60 TAGCTTTGATGGCTGCCTTT Chr17:3145156..3145175 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658492 Chr17:3114967..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60
upstream ENSMUSE00000658491 Chr17:3114979..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60

*** Putative Vector Insertion (Chr 17: 3115419 - 3145074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367004 Chr17:3145075..3145158 TAGCTTTGATGGCTGCCTTT Chr17:3145156..3145175 59.98 45
downstream ENSMUSE00000468506 Chr17:3148536..3148580 No primer for this exon
downstream ENSMUSE00000547043 Chr17:3150785..3150943 GCAACCACATGGGTAGATCA Chr17:3150893..3150912 59.37 50
downstream ENSMUSE00000379333 Chr17:3159163..3159324 ATTGTCGCACAATGGAGTCA Chr17:3159223..3159242 60.12 45
downstream ENSMUSE00000345755 Chr17:3162959..3163112 CCAAAACAGGCGTGACAACT Chr17:3163082..3163101 61.12 50
downstream ENSMUSE00000392504 Chr17:3164147..3164277 TCAGGTAAGCCTTGGACCAC Chr17:3164201..3164220 60.11 55
downstream ENSMUSE00000348840 Chr17:3167963..3168139 CAAGGCCTGCAGGATAGAAG Chr17:3168034..3168053 59.97 55
downstream ENSMUSE00000333169 Chr17:3169327..3169406 TGCTCAGAATCTTCCCCAAA Chr17:3169370..3169389 60.71 45
downstream ENSMUSE00000445526 Chr17:3171103..3171220 GTCGCAACTGCTCCAAGTTC Chr17:3171191..3171210 60.99 55
downstream ENSMUSE00000367371 Chr17:3177093..3177224 TTGGCTACTCCCTTGTGAGG Chr17:3177170..3177189 60.25 55
downstream ENSMUSE00000280233 Chr17:3177611..3177723 CAACAACATCTTGCCCTTCA Chr17:3177647..3177666 59.69 45
downstream ENSMUSE00000280209 Chr17:3178155..3178348 CTTCCTGTGCTTTCGCTTTC Chr17:3178218..3178237 60.13 50
downstream ENSMUSE00000280184 Chr17:3185064..3185164 CTTGGCCAACCCAGAGAGTA Chr17:3185096..3185115 60.25 55
downstream ENSMUSE00000235905 Chr17:3185761..3185874 TTTCTGAAGAGCCCGAAATG Chr17:3185835..3185854 60.32 45
downstream ENSMUSE00000280138 Chr17:3187589..3187745 TATGTGACGCCAAGATCCAC Chr17:3187665..3187684 59.53 50
downstream ENSMUSE00000403192 Chr17:3190147..3190280 AGGAGGAGGGAAAACCTCTG Chr17:3190268..3190287 59.67 55
downstream ENSMUSE00000280487 Chr17:3191817..3191961 GGAAACGCTGGAGGAACTAA Chr17:3191872..3191891 59.31 50
downstream ENSMUSE00000445485 Chr17:3193014..3193082 TGGTACTACCGGTGGGATTG Chr17:3193081..3193100 60.63 55
downstream ENSMUSE00000280452 Chr17:3195778..3195993 GTCATGGACAATGGTGGTTG Chr17:3195808..3195827 59.66 50
downstream ENSMUSE00000400161 Chr17:3196760..3198855 GTAAGCCTTTTGGACCACCA Chr17:3197746..3197765 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAGTTGTAATCGCCTTG Chr17:3127461..3127481 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGATTGACCGTTCTGCAT Chr17:3127412..3127432 61.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046201